Oligo BGISUSO0000000057

Oligo nameBGISUSO0000000057
GeneP2RX2
TM78.43
SequenceGTCAAAGGTCTCACCTTGTCAGAGCACAAAGTGTGGGACGTGGAGGAGTACGTGAAACCC