Oligo BGISUSO0000000058

Oligo nameBGISUSO0000000058
GeneNP_570721.1
TM79.8
SequenceCTGATTGGCACGTGACTTTCACGGGCATGTCTCGTCGGCAGATGATCTACAGCGCAGCCA