Oligo BGISUSO0000000064

Oligo nameBGISUSO0000000064
GeneNP_116287.1
TM75.02
SequenceATGAGAATGAAATGAAGGGGAAAAGTCGCCAGCGCATTATGCCAGTCCGAAACTTTTCCA