Oligo BGISUSO0000000066

Oligo nameBGISUSO0000000066
GeneNP_775855.2
TM81.85
SequenceCTCGGGAGCTGTTTCTGCTGTGTGACAAGGAGGCCAAGGGCTTTGTCACCCGGCACGACC