Oligo BGISUSO0000000068

Oligo nameBGISUSO0000000068
GeneXP_292596.1
TM78.43
SequenceCGCTCTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAA