Oligo BGISUSO0000000070

Oligo nameBGISUSO0000000070
GeneNP_079209.2
TM81.17
SequenceGAGAGACATTTGACGAAGCCTTCCTGGCAGCTGTGCGAGCCCATCAAGGGCTCCCTGCTC