Oligo BGISUSO0000000073

Oligo nameBGISUSO0000000073
GeneFHOD3
TM80.48
SequenceACCTGGACTTGGAGGCTACCCTGGCCGAGCAACGGGATGAGTTAGAAGGCTTCCAGGATG