Oligo BGISUSO0000006839

Oligo nameBGISUSO0000006839
GeneNP_997199.1
TM76.38
SequenceGATCCCAAAATTGTTCTCCAAGACGCACCGTGGCTGTTTTTGCTGTTGGAGATTTGGACC