Oligo BGISUSO0000012263

Oligo nameBGISUSO0000012263
GeneSF3B5
TM82.53
SequenceCTTGATGGAGAAGATGCTGCAGCCTTGCGGCCCGCCCGCCGACAAACCGGAGGAGAACTG