Cited By
Trace NameAJ659855
Seq Typeest
SourceGENBANK
Descriptiongi|49344000|gb|AJ659855.1, AJ659855 KN277 Sus scrofa cDNA clone C0005217_B01, mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>AJ659855
GGCAAATGGCAAAGTCATTACCAACAAAGCTGTTAAGGGCAAATATAAGTTCTTACAGAA
GTATTATCACCGGGGTGCCTTCTTCATGGATGAGGATGAAGAAGTATACAAGAGAGATTT
CAGTGCACCTACCCTGGAGGATCATTTCAACAAAACCATTCTTCCCAAAGTCATGCAGGT
CAAGAACTTTGGACGCTCTGGCCGTACCAAATATACCCACCTCGTGGATCAAGATACCAC
CTCCTTTGACTCAGCATGGGGCCAAGAGAGTGCCCAGAACACAAAGTTCTTTAAACAAAA
AGCAGCTGGGGTACGAGATGTATTTGAACGGCCGTCTGCCAAGAAGCGGAAAACTACTTA
GAGTTCAACTGCTTATTTTTCCAGCTGTGGGACACAACAGGAAATCTCAACATCTGGTCT
TTGATTTGCTTTTACTATTATTTACCTGGCCCCTGTATCCAGCCTTCTGGACCTACTGCC
ATACTTGTGATGCTGGGCAAGCCCAGTCTTTGAAA
Download Sequence