Cited By
Trace NameAJ662209
Seq Typeest
SourceGENBANK
Descriptiongi|49346332|gb|AJ662209.1, AJ662209 CSEQRAN09 Sus scrofa cDNA clone C0000023_M16, mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>AJ662209
CCCGCGGTGGCGGCCGCGGCTCGAGGTAGCTTCAAAAGAGCTGGAATGGAATCTCAGCCT
TTCCTGAATATGAAATTTGAAACAGATTACTTTGTCAAGATTGTCCCTTTTCCTTCCATT
AAAAACGGAAGCATCCACTGGGCTCCAGGAGCATGGGCAGAGAGTTTGCTAAATAAACTC
ACTTATGAAAGTTGAAGGGGAAAATTGTGATAGTCCAAAAATCAGGTGATGCTTTAGTTT
GGATTTAGGGTTTGGGTACTTACTTTGAAGTACTAATGATTGTGATGTTCAACAAAATCA
AACTATTGTACCAAGTAATGTGATGATAGTGTGAATACCCAACTCTGAATAGTTTTGAGA
AGTCCAGCTTCCTGGTTTTGCCTTATTAGCTTGACTTTTTAAAAAACCCTCCCCATCTCA
TACTGGAAATGGGAATAAGTTGCTTTATAGATTAAGGCAAAACATTTGTTTTAAGCAGAT
CTGCATT
Download Sequence