Cited By
Trace NameBI360170
Seq Typeest
SourceGENBANK
Descriptiongi|15056198|gb|BI360170.1, 386966 MARC 2PIG Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BI360170
GCGGCTTCTTCTCGTCTGCGGCTTCTGACGCTGCGAGCAAGGGAAAAAGCAACGAGAAGA
CAGACCGCTACACCATCCACAGCCAGTTAGAGCATCTGCAGTCCAAATACATCGGCACCG
GCCACGCCGACACCACCAAATGGGAGTGGCTGGTGAACCAGCACCGCGACTCCTATTGCT
CCTACATGGGCCACTTCGACCTTCTCAACTACTTCGCCATTGCCGAGAATGAGAGCAAAG
CGCGAGTCCGCTTCAACTTGATGGAGAAGATGCTGCAGCCTTGCGGCCCGCCCGCCGACA
AACCGGAGGAGAACTGAGACCTCACCGTCTCACCGCTAGGTCCTTACCCGGGGCGTTCCG
TCCGACCTGCCTTCCTGTGGAACAAAGTGTTGGGAGACCCGTCATAACCCCTGAGAAACT
GAACAGTGGAGAGATCCTAAAGTCTGCAGACGTT
Download Sequence