Cited By
Trace NameBI404390
Seq Typeest
SourceGENBANK
Descriptiongi|15183603|gb|BI404390.1, MI-P-CP1-nwz-a-09-0-UI.s1 MI-P-CP1 Sus scrofa cDNA clone MI-P-CP1-nwz-a-09-0-UI 3', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BI404390
TTTTTTTTTTTTTTTTTTACCGAAACATTTCTAAACTTTATAGAAAAAGCAACGAAGACA
GTCAACTAGCCAAAAACGAGCCTCTTAATCCCATCTCACTCCAGCCATATCTCCTCTAAC
GTCTGCAGACTTTAGGATCTCTCCACTGTTCAGTTTCTCAGGGGTTATGACGGGTCTCCC
AACACTTTGTTCCACAGGAAGGCAGGTCGGACGGAACGCCCCGGGTAAGGACCTAGCGGT
GAGACGGTGAGGTCTCAGTTCTCCTCCGGTTTGTCGGCGGGCGGGCCGCAAGGCTGCAGC
ATCTTCTCCATCAAGTTGAAGCGGACTCGCGCTTTGCTCTCATTCTCGGCAATGGCGAAG
T
Download Sequence