Cited By
Trace NameBP154750
Seq Typeest
SourceGENBANK
Descriptiongi|40404223|gb|BP154750.1, BP154750 full-length enriched swine cDNA library, adult ovary Sus scrofa cDNA clone OVRM10115H10 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BP154750
AGAGTAGCGCCGGGCCGGGCTGGGCGAGCGCACGGCCATGGCCCCGTGGTTGCAGCTCTG
TTCTGTCTTCTTCACCGTCAACGCCTGCCTCAACGGCTCGCAATTGGCCGTGGCCGCAGG
TGGCTCCAGCAGAGCTCGGGGCGGCGACACCTGCGGCTGGAGGGGAGTGGGGCCGGCCAG
CAGAAACAGTGGGCTGCACAACATCACCTTCAGATATGACAACTGCACCACTTACTTGAG
TCCTGTGGGGAAGCATGTGATCGCCGACGCCCAGAATATCACCATCAGTCAGTACGCCTG
CCACGACCAAGTGGCAGTCACCATTCTCTGGTCCCCAGGGGCCCTCGGCATCGAATTCCT
AAAAGGATTTCGGGTAATACTGGAGGAGCTGAAGTCAGAAGGAAGACAGTGCCAACAACT
GATTCTGAAGGACCCGAAGCAGCTCAACAGTAGCTTCAAAAGAGCTGGAATGGAATCTCA
GCCTTTCCTGAATATGAAATTTGAAACAGATTACTTTGTCAAGATTGTCCCTTTTCCTTC
CATTAAAAACGAAAGCAATTATCACCCTTTCTTCTTTAGAACCCGCACCTGTGACCTGCT
ATTACAGCCGGACAACCTGGCCTGTAAACCCTTCTGGAAGCCTCGGAACCTCAACATCAC
CCAACATGGCTCAGACATGCANGTGTCCTTCGACCACGCGCCACATACCTTCGGCTTCCG
TTTC
Download Sequence