Cited By
Trace NameBP164550
Seq Typeest
SourceGENBANK
Descriptiongi|40414023|gb|BP164550.1, BP164550 full-length enriched swine cDNA library, adult thymus Sus scrofa cDNA clone THY010013E03 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BP164550
TGCTCGCGGGGCAGGCCCCTGAGGGACGAGACGGCGTCACTGGACCTGGACACCTTCATC
ACCCCATCATGCAGACCTCAGCGCACAAGCAGCAGCAGCAGCCCGAGGCAACCAAGATCA
GGAACCTGCCCTGGGTTGAAAAATACCGGCCACAGACACTGGATGATCTCATTTCTCATC
AGGACATTCTGAGTACTATTCAGAAGTTTATCAGTGAGGACCGCCTTCCGCACCTCCTTC
TCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCCTGTGCTAAACAGCTGT
ACAAAGATAAGGAATTCGGCTCCATGGTCTTGGAGCTGAATGCTTCAGATGACCGAGGAA
TAGATATCGTTCGGGGACCAATCCTGAGCTTTGCTAGCACAAGGACAATATTTAAGAAGG
GCTTTAAACTAGTGATCTTGGATGAAGCTGATGCCATGACTCAGGATGCCCAGAACGCCT
TGCGGAGAGTGATTGAAAAATTTACTGAAAATACCAGATTTTGCCTCATCTGCAACTATC
TGTCAAAGATCATTCCCGCCTTGCAGTCGCGGTGTACAAGGTTCCGATTCGGCCCCCTGA
CTCCTGAACTCATGGTTCCCCGCCTGGAACATGTTGTAGAAGAAGAGAAAGCTGATATAA
GCGAAGATGGGATGAAAGCGCTCATAACAC
Download Sequence