Cited By
Trace NameBW961768
Seq Typeest
SourceGENBANK
Descriptiongi|71961501|gb|BW961768.1, BW961768 full-length enriched swine cDNA library, adult alveolar macrophage Sus scrofa cDNA clone AMP010092D06 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>BW961768
TGTTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTCTGTTCGT
TGACGTTGTACCTGTTCACAGTTTGGAATCAGTCAAGTTTTGGAATCACCGCCGCTGCCA
TCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACGGCTGGGG
CCGTCCCGGTTCGCAATGAGAAAGGCGAGATTTCGATGGAAAAAGTGAAGGTAAAACGTT
ATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCAGATGAGGAGGATGAAG
AATTTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAAGAGGAGG
ATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTATTAGTGAAGATGTGGAAG
AGAGATTGGCTCGACATCGGAAAATAGTGGAACCCGAAGTGGTGGGAGAAAGTGACTCAG
AAGTAGAAGGAGATGCTTGGCGCATGGAACGAGAAGATACCAGTGAAGAAGAAGAAGAAG
AGATTGATGATGAGGAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGA
GAAAAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGGAGGAGT
CAGAATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATG
Download Sequence