Cited By
Trace NameCB474250
Seq Typeest
SourceGENBANK
Descriptiongi|29280636|gb|CB474250.1, jns01_G07.f jns Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CB474250
CCAAAAAGGCTTGTGCTTTAATCGTAGCTAGGGTAAAGGGGAGCAAAAATAGTAATTCCA
GGGAGCACAGGGAGCAGGTAGCCAGGTCCAGCCTGGCCCAACCCAGGCCAGCTGGGCCAA
AGATGCCAATGTCTTGTTCATGGGGCTGGCGTGTTGGGGAGGCGGATGGACCCCCAGGGA
TGGAGGCCCCTTGGAAAAAAGGGCGGATGACACCTGGCTCAAAAGTCCATGGAGCTGTGG
GCCAGGTAGTCCTTGCGGCCAATGTTGCTAACCTGCTTCGTCTGCATAGCCTCGAGTTTG
GGGCAGTCAGTGATCCGATGGCCCAGGCCCCCACAAAAAGCACAGCCACGCTCTCCTCCA
ATGTCCAGCATGGACTCGTCTCCACAGTGTAGCACTTGCAGCACAGGTGGAACTTTCTGC
TTGGCCTCCAACAGCAGGG
Download Sequence