Cited By
Trace NameCF179995
Seq Typeest
SourceGENBANK
Descriptiongi|33291771|gb|CF179995.1, 815043 MARC 3PIG Sus scrofa cDNA 3', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CF179995
TTTTTGGGACCAGAAAGCTTGTGCTTTAATCGTAGCTAGGGTAAAGGGGAGCAAAAATAG
TAATTCCAGGGAGCACAGGGAGCAGGTAGCCAGGTCCAGCCTGGCCCAACCCAGGCCAGC
TGGGCCAAAGATGCCAATGTCTTGTTCATGGGGCTGGCGTGTTGGGGAGGCGGATGGAGC
CCCATGGATGGAGGCCCCTTGGAGAGAAGGGCGGATGACACCTGGCTCATAAGTCCATGG
AGCTGTGGGCCATGTAGTCCTTGCGGCCAATGTTGCTAACCTGCTTCGTCTGCATAGCCT
CGAGTTTGGGGCAGTCAGTGATCCGATGGCCCATGCCCCCACAGAAAGCACAGCCACGCT
CTCCTCCAATGTCCAGCATGGACTCGTCTCCACAGTGTAGCACTTGCAGCACAGGTGGAA
CTTTCTGCTTGGCCTCCATCAGCAGGGCTTTGAGGTCCATCAGCACTGACTCATCACAGG
CCTTGTTGATGAATGTGGTGGCGATGCCTGTGTTTCCTGAGCGCCCAGTGCGGCCGATAC
GGTGCACATAATTCTCGATCTCCTCAGGCATGTCATAATTGATGACATGCTGGATG
Download Sequence