Cited By
Trace NameCF363535
Seq Typeest
SourceGENBANK
Descriptiongi|34164270|gb|CF363535.1, 833423 MARC 3PIG Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CF363535
GATTGGCTCGACATCGGAAAATAGTGGAACCCGAAGTGGTGGGAGAAAGTGACTCATAAG
TAGAAGGAGATGCTTGGCGCATGGAACGAGAAGATACCAGTGAAGAAGAAGAAGAAGAGA
TTGATGATGAGGAAATAGAGCGACGCCGTGGCATGATGCGTCAACGAGCACAGGAGAGAA
AAAATGAAGAGATGGAAGTCATGGAGGTGGAAGATGAGGGGCGTTCTGGGGAGGAGTCAN
AATCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGCCTCGCCTTA
AGCCAGTCTTCATTCGGAAGAAGGACCGAGTAACAGTTCAAGAACGGGAGGCCGAAGCAT
TGAAACAGAAGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGACGCAAATATA
CACTCAAGATTGTAGAAGAAGAGACCAAGAAAGAGCTGGAGGAGAACAAGCGGTCCCTGG
CTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAATATGAAGCATGGA
AAGTTCGGGAGCTAAAGAGAATCA
Download Sequence