Cited By
Trace NameCF722642
Seq Typeest
SourceGENBANK
Descriptiongi|37596896|gb|CF722642.1, D04_LKF002 UMNMPM3 Sus scrofa cDNA clone PPSL_18D04 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CF722642
CACGCGTCCGTTCTATCAGTACGCAGCAGTGTCCAGTGGCCTCTGGTGCGGAGGATTTTC
TGTTCGTTGACGTTGTACCTGTTCACAGTTTGGAATCAGTCAAGTTTTGGAATCACCGCC
GCTGCCATCAAAATGTCGGTCCCAAGCGCACTCATGAAACAACCGCCTATTCAGTCTACG
GCTGGGGCCGTCCCGGTTCGCAATGAGAAAGGCGAGATTTCGATGGAAAAAGTGAAGGTA
AAACGTTATGTGTCAGGAAAGAGGCCAGACTATGCCCCTATGGAGTCCTCAGATGAGGAG
GATGAAGAATTTCAGTTCATTAAGAAAGCCAAAGAACAAGAAGCAGAGCCTGAGGAACAA
GAGGAGGATTCATCTAGTGACCCTCGGCTGCGACGTTTGCAGAACCGTATTAGTGAAGAT
GTGGAAGAGAGATTGGCTCGACATCGGAAAATAGTGGAACCCGAAGTGGTGGGAGAAAGT
GACTCAGAAGTAGAAGGAGATGCTTGGCGCATGGAACGA
Download Sequence