Cited By
Trace NameCF790452
Seq Typeest
SourceGENBANK
Descriptiongi|37795013|gb|CF790452.1, 875581 MARC 4PIG Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CF790452
CGCGTGTACAGAGGTTCCGGCGGGTGGCTCCTCTCCGGCTTGAAACCTTAGAGCGGCTTC
TTCTCGTCTGCGGCTTCTGACCTGCGAGCAAAGGAAAAAGCAACGAGATGACAGACCGCT
ACACCATCCACAGCCAGTTAGAGCATCTGCAGTCCAAATACATCGGCACCGGCCACGCCG
ACACCACCAAATGGGAGTGGCTGGTGAACCAGCACCGCGACTCCTATTGCTCCTACATGG
GCCACTTCGACCTTCTCAACTACTTCGCCATTGCCGAGAATGAGAGCAAAGCGCGAGTCC
GCTTCAACTTGATGGAGAAGATGCTGCAGCCTAGCGGCCCGCCCGCCGACAAACCGGAGG
AGAACTGAGACCTCACCGTCTCACCGCTAGGTCCTTACCCGGGGCGTTCCGTCCGACCTG
CCTTCCTGTGGAACAAAGTGTTGGGAGACCCGTCATAAC
Download Sequence