Cited By
Trace NameCJ023267
Seq Typeest
SourceGENBANK
Descriptiongi|54529532|gb|CJ023267.1, CJ023267 full-length enriched swine cDNA library, adult trachea Sus scrofa cDNA clone TCH01D110011 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CJ023267
AGCCGTGGTTCGCTCTGCAGCCTAGCGGGTTGAGCCTGAGCTGGGCGCCGAGGAAGAAGA
CCTGGGTCTTGCCGCACCATGTCTATGGACAGTTCCAGAGTAATGAATCAGTGTGTCTTT
AGAGGAATGGAAGAAAACAAGGAAAGGCCTAAACGGCAGCGGCAAAACAACTTTCCCATG
TTTCCATCTCCTAAAGCCTGGAATTTCAGAGGGCGAAAGCGGAAGCAGAGCACCCAAGAT
GAAGATGCCGTTAGTCTTTGCAGTCTTGATATAAGTGAACCCAGTAATAAACGAGTCAAA
CCCCTTTCCAGAGTCACATCGCTAGCAAACCTCATTCCGCCCGTAAAGGCCACGCCGTTA
AAGCGCTTCAGCCAAACTCTGCAGCGCTCCATCAGCTTCCGAAGCGAGAGCCGGCCTGAC
ATCCTCGCCCCCAGACCCTGGTCCAGAAATGCCGCCCCCTCAAGCACGAAACGGAGAGAC
AGCAAGCTTTGGAGTGAGACCTTCGATGTGTGTGTCAATCAGATGCTTACATCCAAGGAA
ATCAAACGTCAGGAGGCCATCTTTGAGCTCTCCCAAGGAGAAGAAGACTTAATAGAGGAC
TTGAAATTGGCAAAAAAGGCCTATCATGACCCCATGCTGAAACTCTCCATAATGACAGAA
CAAGAGTTGAATCAAATTTTTGGAACACTGGACTCCTTAATTCCTCTACACGAAGACCTC
CTTAGTCAGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAACACGTTGGTCCCATT
CTCGTGGGCTGGGTAAGAAAAGTTCTCTTGTCTTGATTGACGATAAATTTCAGTAATG
Download Sequence