Cited By
Trace NameCJ025168
Seq Typeest
SourceGENBANK
Descriptiongi|54533576|gb|CJ025168.1, CJ025168 full-length enriched swine cDNA library, adult trachea Sus scrofa cDNA clone TCH01B080037 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CJ025168
GGGCACGGCCATGGCCCCGTGGTTGCAGCTCTGCTCTGTCTTCTTCACCGTCAACGCCTG
CCTCAACGGCTCGCAATTGGCCGTGGCCGCAGGTGGCTCCAGCAGAGCTCGGGGCGGCGA
CACCTGCGGCTGGAGGGGAGTGGGGCCGGCCAGCAGAAACAGTGGGCTGCACAACATCAC
CTTCAGATATGACAACTGCACCACTTACTTGAGTCCTGTGGGGAAGCATGTGATCGCCGA
CGCCCAGAATATCACCATCAGTCAGTACGCCTGCCACGACCAAGTGGCAGTCACCATTCT
CTGGTCCCCAGGGGCCCTCGGCATCGAATTCCTAAAAGGATTTCGGGTAATACTGGAGGA
GCTGAAGTCAGAAGGAAGACAGTGCCAACAACTGATTCTGAAGGACCCGAAGCAGCTCAA
CAGTAGCTTCAAAAGAGCTGGAATGGAATCTCAGCCTTTCCTGAATATGAAATTTGAAAC
AGATTACTTTGTCAAGATTGTCCCTTTTCCTTCCATTAAAAACGAAAGCAATTATCACCC
TTTCTTCTTTAGAACCCGCACCTGTGACCTGCTATTACAGCCGGACAACCTGGCCTGTAA
ACCCTTCTGGAAGCCTCGGAACCTCAACATCACCCAACATGGCTCAGACATGCAGGTGTC
CTTCGACCACGCGCCACATACCTTCGGCTTCCGTTTCTTTTATCTTCACTACAAGCTCAA
GCACGAAGGACTCTTCAAACGAAAGACCTGCAAACAGGAGCAAAATACAGAGACAACCAG
CTGCCTCCTTCAAAATGTATCTCCTGGGGATTATATAATTGAGCTGGTGGATGACACNNT
ATACAACAGAAAAGTGATGCATTATGCCTTANNAACAGTGCATTCCCCATGGGCTGGGCC
CATAGAGC
Download Sequence