Cited By
Trace NameCK453469
Seq Typeest
SourceGENBANK
Descriptiongi|40800683|gb|CK453469.1, 909184 MARC 4PIG Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CK453469
CTCCCCTTTGCCCAAGCGCCGGAGTCTGGTCGAGCTAGGCTAGAAGCCGGCTGTCAGTCT
CCGTGTAGCCGCAGCCGCCAGGCACCGTGGAGCTGGGGCCCCCTTTCGCTTGGGAGTTTT
GTGGTCGTATCGGGTCAGCGGTGACATCCCAAAGGGCAGGCCCGGCAGCCGCCATGGTGG
CCAAGGATTATCCCTTCTACCTCACTGTCAAGAGAGCGAACTGCAGCCTGGAGGTACCCC
CGGCCAGCAGTCCAGCCAAGGACGCTGAGGAACCCAGTAATAAACGAGTCAAACCCCTTT
CCAGAGTCACATCGCTAGCAAACCTCATTCCGCCCGTAAAGGCCACGCCGTTAAAGCGCT
TCAGCCAAACTCTGCAGCGCTCCATCAGCTTCCGAAGCGAGAGCCGGCCTGACATCCTCG
CCCCCAGACCCTGGTCCAGAAATGCCGCCCCCTCAAGCACGAAACGGAGAGACAGCAAGC
TTTGGAGTGAGACCTTCGATGTGTGTGTCAATCAGATGCTTACATCCAAGGAAATCAAAC
GTCAGGAGGCCATCTTTGAGCTCTCCCAAGGAGAAGAAGACTTAATAGAGGACTTGAAAT
TGGCAAAAAAGGCCTATCATGACCCCATGCTGAAACTCTCCATAATGACAGAACAAGAGT
TGAATCAAATTTTTGGAACACTGGACTCCTTAATTCCTCTACACGAAGACCTCCTTAGTC
AGCTTCGAGATGTCCGGAAGCCTGATGGCTCGACTGAACACGTTGGTCCCATTCTCGTGG
GCTGGCTCCCTTGTCTTAGCTCCTATGACAGCTACTGCAGCAATCAAGTAGCTGCCAAGG
CTCTGCTGGACCACAAGAAACAAGATCACCGAGTCCAAGACTTCCTACAGCGATGTTT
Download Sequence