Cited By
Trace NameCK455133
Seq Typeest
SourceGENBANK
Descriptiongi|40802347|gb|CK455133.1, 915680 MARC 4PIG Sus scrofa cDNA 5', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CK455133
GATAGGCATTGCCTTCACGGGTTCAGGCAAGACACTGGTGTTCACCCTGCCCGTCATCAT
GTTCTGCCTGGAACAAGAGAAGAGGTTACCTTTCTCTAAGCGCGAAGGGCCCTATGGACT
CATTATCTGCCCCTCGCGGGAGCTGGCCCGGCAGACCCACGGCATCCTGGAGTATTACTG
CCGCCTGCTGCAGGAGGACAGCTCGCCACTCCTGCGCTGTGCCCTCTGCATCGGGGGCAT
GTCTGTCAAAGAGCAGATGGAGACCATCCGACATGGCGTGCACATGATGGTGGCCACACC
TGGGCGCCTCATGGATCTGCTGCAGAAGAAGATGGTCAGCCTGGACATCTGCCGTTACCT
GGCCCTGGATGAGGCTGACCGCATGATCGACATGGGTTTTGAGGGCGACATCCGTACCAT
CTTCTCCTACTTCAAGGGCCAGCGACAGACCCTGCTCTTCAGTGCCACCATGCCTAAGAA
GATTCAGAATTTCGCCAAGAGCGCCTTGGTAAAGCCTGTCACGATCAACGTGGGGCGCGC
CGGGGCTGCCAGCCTGGATGTCATCCAGGAAGTGGAATACGTGAAGGAGGAAGCCAAGAT
GGTGTACCTGCTCGAGTGCCTGCAGAAGACACCGCCGCCCGTGCTCATCTTTGCGGAGAA
GAAGGCAGATGTAGACGCCATCCACGAGTACCTGCTGCTCAAGGGAGTCGAGGCTGTGGC
CATCCATGGGGGCAAAGACCAGGAGGAAAGGACCAAGGCCATCGAGGCGTTCCGGGAGGG
CAAGAAGGATGTCCTGGTAGCCACAGACGTAGCCTCCAAGGGCCTGGACTTCCCTGCCAT
CCAGCATGTCATCAATTATGACATGCCTGAGGAGATCG
Download Sequence