Cited By
Trace NameCT272164
Seq Typereads
SourceGENBANK
DescriptionCT272164 Sus scrofa Blood cells Sus scrofa genomic clone PigE-197P18, DNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CT272164
TTTGTTGCATGATAAACTGAGGTTAACAGCAAGGATAACATTAACAAGCTAAAAGTAATA
GCCAACTAATATTGCCAGTGGCCACTCTACAGCACTTTATATAGATAAACTGGCATCTAT
TCCTCACAGCAATTCTTACAAGGCAAGAATTCCTTTCATCCCCATTTTACAGATGACAAA
ATAACAGGTGTAAGAAGTCACTCAGCCTACAGGCAGCAGAGCCCAGCATGAAATCCAGGC
TGCCAACTCCAAAGCTCTCCTCAGGTTCAAGGCTCTGAGTGTCATGCCAGCCAGTCCTAG
ACCCCTCCCACCACTTACTGGCCACCTGCAGCCACACTTGGAACCACCGAGTCTCGTTCA
GGACCTCCCAGCAGGTGTAGTTCCCCTCATCCTGCAGGCTCAGTGCCTCAATGTGCAGGG
AGCTGGCATTCACCAGACAGAAGCGTGGCTGGGCTGACGGCAGAACTGGAATTG
Download Sequence