Cited By
Trace NameCT394718
Seq Typereads
SourceGENBANK
DescriptionCT394718 Sus scrofa White blood cells Sus scrofa genomic clone CH242-462O22, DNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CT394718
CCACAAGCTGCAGCATAGGTTGCAGATGCGGCTTGGATCTGGTGTGGCTGAAGGCTGTGG
TGTAAGTTAACCGCTGCAGCTCTTATTTGACCCCTGGCAACTTCCATATGGAACAAGGGG
GGGTGGAAAAAATTAAAAATTTAAAAGAAAAAATGGTTCCCAAAACTTGGCCAAAGGCCC
CCAAGGGAAAAAAACCGGTTCTGGTGAAAAAGAAGGCCCAAAACAAAATTTTCAAAATAA
CCCAAAAAAGCCAAGTAAACCAGTCTTTATTAATATTCCCCAAACCAAACCAACCTTAAA
CATTCTACTGGAACACTGCCCATAATCTAAAGCATGCCAACGATACTGGTAGATTTATAA
AGACCAAGTAAAAATAAGATTTAAAAAAATTAGGCTACCAACCCGTTGGCCGAGTTCTGT
CTGGTTCTTGTAACATAATCCAAGATCTTGGAGGTGGTTGTTCTGTTGAAACTAGTTGAA
TATAAAACACAAAATTAAACAGTATTCTTATATGTCTTTCTAAAAAAAAGGTTTAATCAA
ATGACCACTTACTTCTTTTTGCAGTACCTGCCAAATTATCAAGCAAATAGTTCAGTAGCC
TTCTTGTTCCATCTGGTTCCAGATAGAGGTTCAAAATATCCTGGGTAAGTGGATTTCCTG
GAAATATTTTTAAATAGGTAAAATGAAACCAAGACAAGTACTAAAATATTTAATAATTGA
AAAATATACAAAATCACTAGATCATCTTATAATAGTGAATATTAACTACATATATATTAA
CATATC
Download Sequence