Cited By
Trace NameCX065344
Seq Typeest
SourceGENBANK
Descriptiongi|84141486|gb|CX065344.1, PDUts2099F03 Porcine testis cDNA library II Sus scrofa cDNA clone PDUts2099F03 5' similar to homologue to ref|NM_005926.1| Homo sapiens microfibrillar-associated protein 1 (MFAP1), mRNA, mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>CX065344
CCCACGCGTCCGCAGAGTCTGAGTATGAAGAGTACACAGACAGTGAAGATGAGATGGAGC
CTCGCCTTAAGCCAGTCTTCATTCGGAAGAAGGACCGAGTAACAGTTCAAGAACGGGAGG
CCGAAGCATTGAAACAGAAGGAGCTGGAGCAGGAGGCCAAACGCATGGCTGAGGAGAGAC
GCAAATATACACTCAAGATTGTAGAAGAAGAGACCAAGAAAGAGCTGGAGGAGAACAAGC
GGTCCCTGGCTGCGCTAGATGCACTCAATACTGATGATGAAAATGATGAGGAGGAATATG
AAGCATGGAAAGTTCGGGAGCTAAAGAGAATCAAGAGGGACAGAGAAGATAGAGAAGCGC
TTGAGAAGGAGAAAGCAGAAATTGAACGCATGCGAAACCTGACTGAGGAAGAGAGGCGAG
CTGAGCTTCGGGCAAATGGCAAAGTCATTACCAACAAAGCTGTTAAGGGCAAATATAAGT
TCTTACAGAAGTATTATCACCGGGGTGCCTTCTTCATGGATGAGGATGAAGAAGTATACA
AGAGAGATTTCAGTGCACCTACCCTGGAGGATCATTTCAAACAAACCATTCTTCCCCAAG
TCATGCAGGTCAAGAACTTTGGACGCTCTGGCCGTACCAATATACCCACCTC
Download Sequence