Cited By
Trace NameDN105563
Seq Typeest
SourceGENBANK
Descriptiongi|59780727|gb|DN105563.1, 1101551 MARC 4PIG Sus scrofa cDNA 3', mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>DN105563
TTTTTGCCGAAACATTTCTAAACTTTATAGAAAAAGCAACGAAGACAGTCAACTAGCCAA
AAACGAGCCTCTTAATCCCATCTCACTCCAGCCATATCTCCTCTAACGTCTGCAGACTTT
AGGATCTCTCCACTGTTCAGTTTCTCAGGGGTTATGACGGGTCTCCCAACTCTTTGTTCC
ACAGGAAGGCAGGTCGGACGGAACGCCCCGGGTAAGGACCTAGCGGTGAGACGGTGAGGT
CTCAGTTCTCCTCCGGTTTGTCGGCGGGCGGGCCGCAGGGCTGCAGCATCTTCTCCATCA
AGTTGAAGCGGACTCGCGCTTTGCTCTCATTCTCGGCAATGGCGAAGTAGTTGAGAAGGT
CGAAGTGGCCCATGTAGGAGCAATAGGAGTCGCGGTGCTGGTTCACCAGCCACTCCCATT
TGGTGGTGTCGGCGTGGCCGGTGCCGATGTATTTGGACTGCAGATGCTCTAACTGGCTGT
GGATGGTGTAGCGGTCTGTCATC
Download Sequence