Cited By
Trace NameDV226438
Seq Typeest
SourceGENBANK
Descriptiongi|77593902|gb|DV226438.1, EST-AR190G07 Porcine Peripheral Blood Cell cDNA library Sus scrofa cDNA clone AR190G07, mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>DV226438
CGGGCTCGCACCGACGAGGCAACTGCCACAGGAAGCCGCTCCGAGGCGGAGGATGAGGAC
GATGAGGATTATGTACCCTACGTACCACTGCGACAGCGCCGGCAGTTGCTGCTCCAGAAG
CTGCTTCAGCGAAGGCGCAAGGGAGCTGCGGAAGAGGAGCAGCAGGACAGCGGCAGCGAA
CCCCGAGGAGATGAGGACGACATCCCGCTGGGCCCTCAGTCCAACGTCAGCCTTCTGGAT
CAGCACCAGCACCTCAAAGAGAAGGCTGAAGCCCGCAAAGAGTCTGCCAAGGAGAAGCAG
CTGAAGGAAGAGGAGAAGATCCTGGAGAGTGTAGCTGAAGGTCGAGCCTTGATGTCAGTG
AAGGAGATGGCTAAGGGAATCACATACGACGACCCGATCAAAACTAGTTGGACACCACCC
CGGTATGTTCTGAGCATGTCTGAAGAGCGGCATGAGCGTGTACGGAAGAAGTACCACATC
TTGGTGGAAGGTGATGGGATCCCACCACCCATCAAGAGTTTCAAGGAAATGAAATTTCCT
GCAGCCATCCTGAGANNCCTAAAGAAGNNNNNCATCCACCACCCAACACCCATTCAGNNN
NANNNNNNTCCCACCATTCTCTNNNNNNGNGNCATG
Download Sequence