Cited By
Trace NameDV227343
Seq Typeest
SourceGENBANK
Descriptiongi|77595612|gb|DV227343.1, EST-AR122A09 Infected Porcine Spleen cDNA library Sus scrofa cDNA clone AR122A09, mRNA sequence
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>DV227343
GCTGTAATGGGAAAAATGGGACAACCAATGGAAGGATCACTCACGGTTTCAAGTTAAAGA
GTGCCTANGNNNGTGGCCTGATGCCTTACACAAATTACACATTTGATTTTAAGGGNATAA
TTGACTACATCTTCTATTCTAAACCTCAGNTGAACACT
Download Sequence