Cited By
Trace Namebdd_24593.z1
Seq Typereads
SourceSDJVP
Clip_quality_left54
Clip_quality_right707
Clip_vector_left0
Clip_vector_right846
Library_idbd
Plate_idbdd_245
StrainDuroc
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>bdd_24593.z1
GGCGCAGTGATCAAGGATCCGATATGGATCAGATCTCAAAGTTCCAGATTCTGAATTAAC
ACACTAGTCGTGTTGTGCTCATGTCTTGAAAAACTATTCTGAAGCAACGACTAAGGTTGT
GGCAAGTTGTACGTACCTGCAAAATATTCAGGGCCCTTCGCATATCTCCACTGGAAAGTG
TTATGAGCGCTTTCATCCCATCTTCGCTTATATCAACTCTAAAAGGAAATGGCAGAAAGG
TTTTAGAGGCCCTGGGAACATAAGCATTCCCCAAGGGAACACGATGGCCTGGGATGATCA
AGGCTTTGAAGCAACACAAGAAGAAAAGGTAAGGACGGAGTTCCCAACACTCCCCTGGTC
TACAGGATCCAGGCCTCACTGGGGATGTGAGCCTCAAGTTAGCAGTCACAGCTCAGATCC
AGAAAGACCCTATTTAGGACCAAGCCCTGCTGTGCTGAGCAAGCAGCTTTGAATTCTGTC
CACTGCGAGGGAGAGGGCACTGGCTCTGGGGTCCCAGAGTCGAAGCACCTCCTTTCAGAT
CAGCAGTAGCTCAGGGTGGCTACTGGTATGGCATGTGATTACACACAATGTGATGTCTCA
GACCTTCCCTTCTAGGTACAAAGGGCTAGAAGCATCTCAGCAGAAGGGACTTGGCAGCTG
CTGTCTCCAATGATAAAAGAAGAGTAGGAGGGAACTGGGACAGCTTCCAGAGGAGGAGGA
TGGACTCAAGAGAACCAAATGCATTTTCTTTTCCCTTGGTTGCACCCCCAGTGTGTGGGA
AGTCCGGGGCCAAGACTGGAACCGGGTCATGCATGTGGGCCAAGGCCAAACAAGGGCACC
ATTAGA
Download Sequence