Cited By
Trace Namebdf_74693.z1
Seq Typereads
SourceSDJVP
Clip_quality_left42
Clip_quality_right683
Clip_vector_left0
Clip_vector_right700
Library_idbd
Plate_idbdf_746
StrainDuroc
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>bdf_74693.z1
GGCCTGATTCATCTAAGATCCCTGATGCGTGATCCGAAGCAGACGTGGACTGAGGGCCCA
GCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCGCTGTCCTGCTGCTCGTGTTCCG
CAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAGCTGAGGTTCCACGAGCGCCTCTC
AGAGCCGAGTCCAATGCAGAGTGGGGCATTGGACCCAGGGGCAGGTGTCAGGATCCTGGC
TCTTGGGAGAGGATCCTGTGCCCCGAGGTGCAGAGCTGCCCCATCCCTCAGATCACGTCG
CCTCACCAGTTCCCCCCTTTGCCTGGGGACCATGCTCCTGTATACTGACACCTCACTCTG
CAAACCTGGGGCCATCCCCCATGCCACAGCCAAACCCTCATTCCTGCCCTCATTCGTCCC
CGCGACCCAGGGCCCTGACCAGCAACTGCCGGCGCTGTCGCAGTGGTACGTAGGGTACAT
AATCCTCATCGTCCTCATCCTCCGCCTCGGAGCGGCTTCCTGTGGCAGTTGCCTCGTCGG
TGCGAGCCCGCTGCAGATATACACGAGTCAAGGCCCAGACTCCCCGACTTCATTACCACT
CGCAACCCACGCGGACCCCAGCGAGCAAAGCTCCCAGCTTCCTCTCTGGTTCGGATTCCT
CCATTCTTTGCTATACGCATGCGCGCCACGGGAAAACCCC
Download Sequence