Cited By
Trace Namecpg0_036691.z1
Seq Typereads
SourceSDJVP
Clip_quality_left24
Clip_quality_right715
Clip_vector_left0
Clip_vector_right733
Library_idcpg_1
Plate_idcpg1_0366
StrainErHuaLian
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>cpg0_036691.z1
GGTCGATCTAGAGGATCCCGGACTTCCTCATATCCTGTTGCAAAGCCCTTGCATTTCATT
TCATGTCTTCAGCAACCCGGTAAGGAGCTAGAAAAATACTGAAGGACTCTTTCAGCAAAC
TACATGAAACAGTACTTTACAGAGGCTTTCTATTTTTAAAAATCCAGCAAGACAATGAAA
AGTAACTTGTTCAAGTACTTCTCCAGCCATCCAGACACTTGGTAAATACAATACAGGGTA
ACAGTTGCCACAGATTCCAGCTTAGACAGATTGGCAGTTACAGTACAGGGACAAAAGTAC
AGATAGAAGAGAACTGGGTGAACATGGTCACACAAGTATTAAAAAGTGCTTCTCCAAATC
GTTCCATGTGTGGAATGCAAATACTGTACAGGTAAGACACAGGGTACTTCCAAGAAGTAC
ATGCTTCTGTCAGACATTGCTTTCAACATGCCTGCTGTTCCCACAGGAAGAGTCTGTTTG
CTCCATGCGCTCACAGTCTAGGCTGACTTCACTCGTGTCCATACTACAATCTGATTCACT
GTCTGACTGGTCCATCTGCTCAAGTTTTGTTTCTCCTTGTAGCTCCCTGCCCCTGGTGGC
GGGATCTAGGAACGGTCCCTCAGAGTCAAGTACCCCAGCCTGGCCAGCAGCACACAAAAC
TGTCTCTTTGGCTTGACGAATACAGTTGAGCCACTGCTGTTTGTTGAAGGTGTCGTTGGC
CTGCAGTGAGTGG
Download Sequence