Cited By
Trace Namedpcxa0_045173.z1
Seq Typereads
SourceSDJVP
Clip_quality_left52
Clip_quality_right614
Clip_vector_left0
Clip_vector_right954
Library_iddpcxa
Plate_idca_0451
StrainHampshire
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>dpcxa0_045173.z1
NNAGGGGNNGGACGATGCATGCTGCAGGTCGATCTAGAGGATCCCCTTATAGGATGTGGC
TTTAACAACTGAGTCAGATTTTTCCTTTTTTTTTTTTTTTTTTTTTTTTTCTTTTTTTTT
CTTTTTTCTTTTTTGGTCTTTTCTAGGGCTGCACCTGCAGCACATGGAGGCTCCCAAGCT
AGGGGTCTAATCGGAGCTGTAGCCGCCGGCCTACACCACAGCCACAGCAACGTGGGATCT
GAGCCGAGTCTACGACCTACACCACAGCTCACGGCAACACCAGATCCTTAACTACTGAGC
GAAGCCAGGGATTGAACCCGAAACCTCATGGTTCCTAGTTGGACTCATTAACCACTGAGC
TACGACGGGAACTCCCTGAGTCAGATTTTTCATTCCTAAACCTGCCCCAGCTTTGAACAT
AGGACTGAAGTGCACTCAGCCCAACTCAAGGGCCCACGGTGAATGAGGCACCTCTCAGAG
ACTGACAGTGTCTCTCTTTTTCCCCAATCTTCAGTTCAGAAGTTTATCAGTGAGGACCGC
CTTCCGCACCTCCTTCTCTATGGTCCTCCAGGCACGGGAAAGACATCCACCATCCTGGCC
TGTGCTAAACAGCTGTACACAGATAAGGAATTCGGCTCCCTGGTCTTGGACGTCACTGGG
AGGATTACTCTTATTCTCTAAGGACTCCCGTCTCCTTTAATCTGCTAGTTTTTCGTCCGT
TGGGTTTTTCCAAGCCAGCACCGGCGGACCTGGAAGTTCCCCGGCTAGGTCCCTTCCGAG
CTCACGTGTGGCCGCCCACCACAGGCCCGCTGGCGGTTCCACCCGTTGGGCCTTACCCGT
CCCGCTCCGTTTATCGCGTGGCCGACCCCCGGTCTCTGCCACGTGTTTGCCCCCCGACTC
CTTTGTTGCTCTCGGGGGACCCCACTTTTAGCGAACGGTGCACCAGGGCNCNCG
Download Sequence