Cited By
Trace Namerbda_81234.y1
Seq Typereads
SourceSDJVP
Clip_quality_left421
Clip_quality_right667
Clip_vector_left0
Clip_vector_right700
Library_idbd
Plate_idbda_812
StrainDuroc
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rbda_81234.y1
TAAAGTAATAGCTTTTCTGTATCTTACTCCTAGTCTCATGATGATTCCTAGTCCTGAGTG
CAATCACTGAGCTGCACCGTCATGTCAGTGTTGGTTACGGGGGTCCAATCAAAGTAAACG
CCAGAAGCCAATGTCATAGTCATCGGTGGCAAACTCCCAGCAGACACGCTTCCCCTCACG
GATGGGTAGGGAGCCGGATGGTCACCACCTCGCCCCGGTTCACCACCGAGACGGTTGTTC
TGTACTCTTTACCCATGGCCTGCTTTTGAATTCCTTCATCTTGGCAAAGGTCCAGATTCA
CGGAGGAGCCATCAGAGGTGGGGAGACTGAAAGGAAAGGCGGTTGACTAGTGAGAAAGGA
AGCCAGAGGATATGCTGCCTCGCCCGGCGACCTGCTTCGTGGGGTCTGTCGCAGTCAAGG
ACCTTCCTCCTGACTTCCTTCCACAAGTCCCTTTCTTTCTTTCCTTCCATCTGTCTGCCT
TGCTTTAAGTTCATAGCTGGGAATAAGCGAAGCAAACAAACATCTTCGACACCCCTAAAG
TTCTCACCGTTCCTGTGGTCCCCCAGGAGGTCTGCAGATTCCAGATCAGCTGAAAGAGTA
TCTATGGCTCCCGTGTGCTCCGACTGGATCATAACGATGTCCCCAGACCTTGGCGGACCG
GGGTACCTGTGCATCTAGACAAGAGAATTCCGGTTAACGG
Download Sequence