Cited By
Trace Namerbla_29637.y1
Seq Typereads
SourceSDJVP
Clip_quality_left38
Clip_quality_right607
Clip_vector_left0
Clip_vector_right608
Library_idbl
Plate_idbla_296
StrainLandrace
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rbla_29637.y1
TTAGACGAATGACTCGTTTTAGTCACTAGCTTTCTGTGGGCTGATGGACAGGTTTGTTGT
CTTCTTTTATCTAATATAGCTGGAAAGCCACATCTTGGAACAGAAAAACAAGTTATTCTT
GGTGGCTAATGCTCATATGCATTGGGACCCTGAATACTCTGATGTGAAGTTGGTTCAAAC
GATGATGTTCCTCTCAGAAGTGAAGAACATTATTGACAAAGCTTCAAGAAGCCTTCAGTC
CAGTGTATTGGGAGAATTTGGAACTATTCCACTGGTGTTGTGTGCAGATCTTAATTCTTT
GCCGGACTCTGGTAAACACACACACAAATGCTCTTTTATTATGTAGAATATATACTGACT
TAAAAAAAGTTTTTGTAATGTGTTGTTTCTGATAATTCCAAATTTCATTAGTCAAAATGA
AAATTCAGTTTCTACAGTTTGTAGTGGCAGCTCTGAATCAGGTTAAAACATTTTTTTGTG
GAGTAGGGAGACCATTTTGAAAATGAAATTATATTATGAAAAACCTCAGGAGTGAAGGAT
GTTAATCATCTTCAGTAAGCACGTAGGTGATAAATTGAAGTAACTCATTAAAGAACATAT
AATTGTAT
Download Sequence