Cited By
Trace Namerby_15614.y1
Seq Typereads
SourceSDJVP
Clip_quality_left53
Clip_quality_right578
Clip_vector_left0
Clip_vector_right579
Library_idby
Plate_idby_156
StrainYorkshire
Chemistry_typet
Descriptionnull
The chromatogram file is not available

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rby_15614.y1
TTTTCTCGGACGGAATGACTCTTAGATAGTCTAGTCTTATCTGGAGATCCAGGATCTACA
TTTTAACATACTCTTAGGAGATTTTGATATGCAGCCAGATTGATACCCAGTTCTCTGGGG
TCCCCTAAAATACAAGATTTCATTCTGTGCTGATTTGCTAGACCTGTGTCAATACCTGTT
GATTGATGGAGGCTGCAGGGTGGAGCCGAGCCATGTCCTGGATCAGTGGGACACAATTAG
TAATGAATTGGTGATATCTGCTGTGGGTACTGGGGGTTCGTGGCACTGCATGTCTTGCCT
TTGGCTTGGAAAAATACCTGTCCCTTAACCTTTTTTTTTTTTTTTTTTTAATGTGTTTTT
CATTTCTAGTTAAAAACTTCTTCAGAGTAAGTTTCAAAAATGGATCCCAAAGTCAGACCC
ACTCACTGCAGGCCAACGACACCTTCAACAAACAGCAGTGGCTCAACTGTATTCGTCAAG
CCAAAGAGACAGTTTTGTGTGCTGCTGGCCAGGCTGGGGTACTTGACTCTGAGGGACCGT
TCCTAGATCCCGCCACCAGGGGCAGGGAGCTACAAGGAG
Download Sequence