Cited By
Trace Namerbye_77376.y1
Seq Typereads
SourceSDJVP
Clip_quality_left52
Clip_quality_right555
Clip_vector_left0
Clip_vector_right573
Library_idby
Plate_idbye_773
StrainYorkshire
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rbye_77376.y1
GGCCGGTACCTCCTCTTCTTCAGCGCTTCTCTGGGAGACTCTTGCGGGCGACAAAAGCAG
CAGAAGGTGTCAGAAAGACACTAAAGCAAGTACCAAGCTGAGCCTCCCTCTGGTGCCCAA
CTCACCTTCAGCCTTCTCTTGAGGTGCTGGTGCTGATCCAGAAGGCTGACGTTGGACTGA
GGGCCCAGCGGGATGTCGTCCTCATCTCCTCGGGGTTCGCTGCCGCTGTCCTGCTGCTCC
TCTTCCGCAGCTCCCTTGCGCCTTCGCTGAAGCAGCTTCTGGAGCTGAGGTTCCACGAGC
GCCTCTCAGAGCCGAGTCCAATGCAGAGTGGGGCATTGGACCCAGGGGCAGGTGTCAGGA
TCCTGGCTCTTGGGAGAGGATCCTGTGCCCCGAGGTGCAGAGCTGCCCCATCCCTCAGAT
CACGTCGCCTCACCAGTTCCCCCCTTTGCCTGGGGACCATGCTCCTGTATACTGACACCT
CACTCTGCAAACCTGGGGCCATCCCCCATGCCACAGCCAAACCCTCATTCCTGCCCTCAT
TCGTCCCCGCGACCCAGGGCCCTGACCAGCAAG
Download Sequence