Cited By
Trace Namercpg0_036691.y1
Seq Typereads
SourceSDJVP
Clip_quality_left58
Clip_quality_right667
Clip_vector_left0
Clip_vector_right668
Library_idcpg_1
Plate_idcpg1_0366
StrainErHuaLian
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rcpg0_036691.y1
AGTTGCTGGAGCGAAAGTCCTGGTCCTGCTCTTTCTGTAGGAAAAAGTCTTCTTCAGTGG
GGCCCTAGGGAGGACTCCTATAGGAAAGGAATGGATGCATCTAGAGATGCCTTCAACCTC
CAACTTCTGTTCTCCTGGAGGTAAATTGAGCCTAGAACTTGAGAAGCCAGTGTGAACCTG
GTACCCTCTTATCCATAGAGGTCCATTTATTAACCATTTGCTAGATGATTGCTTAGGGGA
ATCCTGTGGATTCTTTTCTTCCAGAAACTGCATGTTTTCCTCTTCCAAGAAGTGCTTGTG
ATCACTCGAGCCGTCACCCACAATGAACAGCTCTGCTACCAGTTGTACCGACAGCCTATC
CCCGTGAAGGACCTCCTGCTGGAAGACCTGCAGGACGGAGAAGTGCGGCTGGGCGGCTCC
CTGCGAGGGGCATTCAGCAACAATGAGAGAAGTATGGGGGACTGTTTGTTTTGACCTGTT
GAACATCTTTGGTTGTGGTGGTGTGGAGGGAGTGGCTGGCTGGTGAAAAGGGAAGAGCCA
TGGCCTTGGAGTCAAATGGCCTTCCAGTTTGTTTCATTACTTGTGTAACCTTATTCAACC
TCTGTGAGCCTGAGTTTCCTATCTGCAGAGTGTGGCGTGGGGAGGTACATGCATTACCTA
CTTCATAG
Download Sequence