Cited By
Trace Namerdpbxa0_050790.y1
Seq Typereads
SourceSDJVP
Clip_quality_left29
Clip_quality_right558
Clip_vector_left0
Clip_vector_right563
Library_iddpbxa
Plate_idba_0507
StrainYorkshire
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rdpbxa0_050790.y1
NGGGAGATACATCAGCCGGTACCCTCTTTTAACATAAGCCACATACAGGTCCAGATTCCT
TGACTACCTTTCTCGAATATGATTTGGTGATTATAAAAGGATTGTTGTAGAATACAATTC
AACAGTTAAGAGTCAGCAGACAGTAAATACCTTTGCGTGAGAATTTGCCTAAGGAAACCT
CCCTTCCCACCACTGTTCTTCTGAGGACAATTGGCTATTTATTTAGTTCCAGAGATGCAC
ACAACTGGCTTTGATCTGCCAGGCATCAACATTAAGGTGAAAGGAAAGTCAGATTTGATA
GAACATCATTTAAGAGTGAGGAGCTCCCATGTTTTCTTTTTGTAAACCATGAAGTATAGA
AAGTATCATATACCTTGGCCCACTTTAGTCCATAGGCAACATTTCAAACAAACAAACAAA
AACTTTTACCTGGTTTTAAGGCATAATGCATCACTTTTCTTGTTGTATTAGTGTCATCCA
CCAGCTGCAAAACAGAGGACCTGTGTTATTTTTTTTAAGTAACAGCATCTCAACAGATCT
CATTCATTTTTTCATCTGTGGNN
Download Sequence