Cited By
Trace Namerdpcxb0_287908.y1
Seq Typereads
SourceSDJVP
Clip_quality_left136
Clip_quality_right427
Clip_vector_left0
Clip_vector_right595
Library_iddpcxb
Plate_idcb_2879
StrainHampshire
Chemistry_typet
Descriptionnull
show trace file
download trace file

Sequence

↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
>rdpcxb0_287908.y1
GATGATCGAGTCGGTACCAAAAATACGTTAATGCTGCTACACATACAAACGCCAGACCTT
ACATAAGCCTCCTACCACTGTCCTGGAATCTTAACTCCAGAGTACGGGTGGTGTTACCAA
TAAGAGCCCACTGCAATATCCTATAGTTTTCCAAAAATCTAACCTTTAAAGTTATCTTTG
GGTCTGGAGACAAGCATCTTTAAACAGCATGAATTTGGCCAACTCCAGACATGCTCCATG
TAATTTGAGAAGATGAACTTGGAAAGTAAAAAAATGTTTAAGTCAAACTGTTCTCGTTCT
CCCAACTCTCTAGACTGGACCACTTACTTGAGTCCTGTGGGGAAGCATGTGATCGCCGAA
GCCCAGAATATCACCATCAGTCAGTACGCCTGTCACGAACAAGTGGCAGTCACCATTCTC
TGGTCCCCAGAGGCCCTCGGTAAGTGGTCATAATGGAGTCTAGCAAAGTGGCTGAATAGA
TGGTGCCAGTGCACGGGTCCCAGGTGTGACAGGCCCCGAGGGGCCAGAAAGTACTGGACC
CTGAAGCCTAGACAGGGGCCAGGGGGCAGAGAACGTTGCAAACATAACAGGGGCA
Download Sequence