Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000071246 (click for geneview)
Transcript ID ENST00000167106(link to ensembl)
Symbol KIAA1036
Localtion Chromosome:14:76298285:76319109:1 band: 14q24.3
Description Vasohibin. [Source:Uniprot/SWISSPROT;Acc:Q7L8A9]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--P--G--G--K--K--V--A--G--G--G--S--S--G--A--T--P--T--S--A--A--A--T--A--P--S--G--V--R--R--L--E--T--
ATGCCAGGGGGGAAGAAGGTGGCTGGGGGTGGCAGCAGCGGTGCCACTCCAACGTCCGCTGCGGCCACCGCCCCCTCTGGGGTCAGGCGTTTGGAGACCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--E--G--T--S--A--Q--R--D--E--E--P--E--E--E--G--E--E--D--L--R--D--G--G--V--P--F--F--V--N--R--G--G--L
GCGAAGGAACCTCAGCCCAGAGAGATGAGGAGCCAGAAGAGGAAGGGGAAGAGGACCTGCGAGACGGAGGCGTCCCCTTCTTTGTCAACCGGGGTGGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--V--D--E--A--T--W--E--R--M--W--K--H--V--A--K--I--H--P--D--G--E--K--V--A--Q--R--I--R--G--A--T--D-
ACCTGTGGATGAGGCCACCTGGGAAAGGATGTGGAAACACGTGGCCAAGATCCACCCCGATGGAGAGAAGGTGGCGCAACGGATCCGTGGGGCCACAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------><---------------------------------------------------------------------------------------><-
-L--P--K--I--P--I--P--S--V--P--T--F--Q--P--S--T--P--V--P--E--R--L--E--A--V--Q--R--Y--I--R--E--L--Q--
CTGCCCAAGATCCCCATACCGAGTGTGCCTACGTTCCAGCCGTCTACACCTGTCCCTGAGCGCCTGGAAGCTGTGCAGCGCTACATCAGAGAGCTGCAGT
         ::.:::::::::::::::: :::::::::::: :::::.::::::::.:::.:.::::::::.:::::::::::::::::.::::::    
---------ATTCCCATACCGAGTGTGCATACGTTCCAGCCCTCTACGCCTGTCCCCGAGTGTCTGGAAGCCGTGCAGCGCTACATCAGGGAGCTG----
----------I--P--I--P--S--V--H--T--F--Q--P--S--T--P--V--P--E--C--L--E--A--V--Q--R--Y--I--R--E--L-----

------------------------------------------------------><--------------------------------------------
Y--N--H--T--G--T--Q--F--F--E--I--K--K--S--R--P--L--T--G--L--M--D--L--A--K--E--M--T--K--E--A--L--P--I
ACAATCACACAGGGACACAGTTCTTTGAAATTAAGAAGAGCAGACCTCTGACAGGGCTGATGGACCTGGCCAAGGAAATGACCAAAGAGGCCCTGCCAAT
                                                        :::::::::::::::::::::::::::::::::::.::::::::
--------------------------------------------------------CTGATGGACCTGGCCAAGGAAATGACCAAAGAGGCTCTGCCAAT
---------------------------------------------------------L--M--D--L--A--K--E--M--T--K--E--A--L--P--I

-----------------------------><---------------------------------------------------------------------
--K--C--L--E--A--V--I--L--G--I--Y--L--T--N--S--M--P--T--L--E--R--F--P--I--S--F--K--T--Y--F--S--G--N-
CAAATGCCTGGAAGCCGTGATCCTGGGAATTTACCTCACCAACAGCATGCCCACCCTGGAGCGCTTCCCCATCAGCTTCAAGACCTACTTCTCAGGGAAC
:::::::::::::::.::::::::::::                                                                        
CAAATGCCTGGAAGCTGTGATCCTGGGA------------------------------------------------------------------------
--K--C--L--E--A--V--I--L--G-------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--F--R--H--I--V--L--G--V--N--F--A--G--R--Y--G--A--L--G--M--S--R--R--E--D--L--M--Y--K--P--P--A--F--
TACTTCCGCCACATCGTGCTGGGGGTGAACTTCGCGGGCCGCTACGGTGCGCTGGGCATGAGTCGGCGCGAGGACCTGATGTACAAGCCGCCCGCCTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--T--L--S--E--L--V--L--D--F--E--A--A--Y--G--R--C--W--H--V--L--K--K--V--K--L--G--Q--S--V--S--H--D--P
GCACGCTCAGCGAGCTCGTGCTGGACTTCGAGGCCGCCTACGGCCGCTGCTGGCACGTGCTCAAGAAGGTGAAGCTGGGCCAGAGCGTGTCACACGACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--S--V--E--Q--I--E--W--K--H--S--V--L--D--V--E--R--L--G--R--D--D--F--R--K--E--L--E--R--H--A--R--D-
GCACAGCGTGGAGCAGATCGAGTGGAAGCACTCGGTGCTGGACGTGGAGCGCCTGGGCCGCGATGACTTCCGCAAGGAGCTGGAGCGCCACGCCCGCGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------------------------------------------------------------------------
-M--R--L--K--I--G--K--G--T--G--P--P--S--P--T--K--D--R--K--K--D--V--S--S--P--Q--R--A--Q--S--S--P--H--
ATGCGGCTCAAGATTGGCAAAGGGACGGGCCCTCCCTCTCCCACCAAGGACCGGAAGAAGGATGTTTCTTCCCCGCAGCGGGCCCAGTCCAGCCCCCACC
            ::::::::::::.: :::::::::::.:::::::::::::::::::::::::: ::.::::: ::::::: :::::::::::::::::
------------ATTGGCAAAGGGGCCGGCCCTCCCTCCCCCACCAAGGACCGGAAGAAGGATGTATCCTCCCCTCAGCGGGGCCAGTCCAGCCCCCACC
-------------I--G--K--G--A--G--P--P--S--P--T--K--D--R--K--K--D--V--S--S--P--Q--R--G--Q--S--S--P--H--

------------------------><----------------------------------------------------------------------->
R--R--N--S--R--S--E--R--R--P--S--G--D--K--K--T--S--E--P--K--A--M--P--D--L--N--G--Y--Q--I--R--V--*-
GCAGGAACAGCCGCAGTGAAAGACGGCCCTCGGGTGACAAGAAGACTTCCGAGCCCAAAGCCATGCCAGACCTTAACGGGTACCAGATCCGGGTCTGA
::::.                                                                                             
GCAGA---------------------------------------------------------------------------------------------
R--R----------------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000887171
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------ATTCCCATACCGAGTGTGCATACGTTCCAGCCCTCTACGCCTGTCCCCGAGTGTCTGGAAGCCGTGCAGCGCTACATCAGGGAGCTG----
--------------------------------------------------------CTGATGGACCTGGCCAAGGAAATGACCAAAGAGGCTCTGCCAAT
CAAATGCCTGGAAGCTGTGATCCTGGGA------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------ATTGGCAAAGGGGCCGGCCCTCCCTCCCCCACCAAGGACCGGAAGAAGGATGTATCCTCCCCTCAGCGGGGCCAGTCCAGCCCCCACC
GCAGA---------------------------------------------------------------------------------------------


>BGISUSP0000887171
----------------------------------------------------------------------------------------------------
---IPIPSVHTFQPSTPVPECLEAVQRYIREL--------------------LMDLAKEMTKEALPIKCLEAVILG------------------------
----------------------------------------------------------------------------------------------------
----IGKGAGPPSPTKDRKKDVSSPQRGQSSPHRR-------------------------------