Sequences
EST Library Info
nbm1Newborn 115 days, bone marrow (pelvis)
nep1Newborn 115 days, epidermis
Clusters
Oligos
SNPs

Gene ID ENSG00000096141 (click for geneview)
Transcript ID ENST00000211373(link to ensembl)
Symbol Q9NZJ1_HUMAN
Localtion Chromosome:6:31782660:31793674:1 band: 6p21.33
Description Megakaryocyte-enhanced gene transcript 1 protein (Lymphocyte antigen 6 complex, locus G6D).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------><-----------------------------------------------
-M--A--V--L--F--L--L--L--F--L--C--G--T--P--Q--A--A--D--N--M--Q--A--I--Y--V--A--L--G--E--A--V--E--L--
ATGGCAGTCTTATTCCTCCTCCTGTTCCTATGTGGAACTCCCCAGGCTGCAGACAACATGCAGGCCATCTATGTGGCCTTGGGGGAGGCAGTAGAGCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--C--P--S--P--P--T--L--H--G--D--E--H--L--S--W--F--C--S--P--A--A--G--S--F--T--T--L--V--A--Q--V--Q--V
CATGTCCCTCACCACCTACTCTACATGGGGACGAACACCTGTCATGGTTCTGCAGCCCTGCAGCAGGCTCCTTCACCACCCTGGTAGCCCAAGTCCAAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--G--R--P--A--P--D--P--G--K--P--G--R--E--S--R--L--R--L--L--G--N--Y--S--L--W--L--E--G--S--K--E--E--D-
GGGCAGGCCAGCCCCAGACCCTGGAAAACCAGGAAGGGAATCCAGGCTCAGACTGCTGGGGAACTATTCTTTGTGGTTGGAGGGATCCAAAGAGGAAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------><-----------------
-A--G--R--Y--W--C--A--V--L--G--Q--H--H--N--Y--Q--N--W--R--V--Y--D--V--L--V--L--K--G--S--Q--L--S--A--
GCCGGGCGGTACTGGTGCGCTGTGCTAGGTCAGCACCACAACTACCAGAACTGGAGGGTGTACGACGTCTTGGTGCTCAAAGGATCCCAGTTATCTGCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--A--A--D--G--S--P--C--N--V--L--L--C--S--V--V--P--S--R--R--M--D--S--V--T--W--Q--E--G--K--G-----P--V
GGGCTGCAGATGGATCCCCCTGCAATGTCCTCCTGTGCTCTGTGGTCCCCAGCAGACGCATGGACTCTGTGACCTGGCAGGAAGGGAAGGGT---CCCGT
                                            ::::::. ::::::: :::::::::::::::::: :::.::::::.::   ::.::
--------------------------------------------GTCCCCGCCAGACGCCTGGACTCTGTGACCTGGCTGGAGGGGAAGAGTT--CCTGT
---------------------------------------------V--P--A--R--R--L--D--S--V--T--W--L--E--G--K--S--\--P--V

----------------------------------------------------------------------------------------------------
--R--G--R--V--Q--S--F--W-----G--S--E--A--A--L--L--L--V--C--P--G--E--G--L--S--E--P--R--S--R--R--P--R-
GAGGGGCCGTGTTCAGTCCTTCTGG---GGCAGTGAGGCTGCCCTGCTCTTGGTGTGTCCTGGGGAGGGGCTTTCTGAGCCCAGGAGCCGAAGACCAAGA
::.:::::.. .  :::::::::::   ::...::.:::.:::::::::::::::::::::::::: ::.:: .:.:::::::::.  ::.::::: :::
GAAGGGCCACTCGAAGTCCTTCTGGT--GGTGATGGGGCCGCCCTGCTCTTGGTGTGTCCTGGGGATGGACTACCCGAGCCCAGGGCACGGAGACCCAGA
--K--G--H--S--K--S--F--W--\--G--D--G--A--A--L--L--L--V--C--P--G--D--G--L--P--E--P--R--A--R--R--P--R-

---------------------------------------------------><-----------------------------------------------
-I--I--R--C--L--M--T--H--N--K--G--V--S--F--S--L--A--A--S--I--D--A--S--P--A--L--C--A--P--S--T--G--W--
ATCATCCGCTGCCTCATGACTCACAACAAAGGGGTCAGCTTTAGCCTGGCAGCCTCCATCGATGCTTCTCCTGCCCTCTGTGCCCCTTCCACGGGCTGGG
:::::.::::::::: :: :::: :::::::::::::::::::::::::::                                                 
ATCATTCGCTGCCTCTTGCCTCAGAACAAAGGGGTCAGCTTTAGCCTGGCA-------------------------------------------------
-I--I--R--C--L--L--P--Q--N--K--G--V--S--F--S--L--A--------------------------------------------------

----------------------------------------------------------------------------------------------------
D--M--P--W--I--L--M--L--L--L--T--M--G--Q--G--V--V--I--L--A--L--S--I--V--L--W--R--Q--R--V--R--G--A--P
ACATGCCTTGGATTCTGATGCTGCTGCTCACAATGGGCCAGGGAGTTGTCATCCTGGCCCTCAGCATCGTGCTCTGGAGGCAGAGGGTCCGTGGGGCTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------><-------------------------------------------------------------------------------------------
--G--R--G--N--R--M--R--C--Y--N--C--G--G--S--P--S--S--S--C--K--E--A--V--T--T--C--G--E--G--R--P--Q--P-
AGGCAGAGGAAACCGAATGCGGTGCTACAACTGTGGTGGAAGCCCCAGCAGTTCTTGCAAAGAGGCCGTGACCACCTGTGGCGAGGGCAGACCCCAGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------><--------------------------------------------------------------------
-G--L--E--Q--I--K--L--P--G--N--P--P--V--T--L--I--H--Q--H--P--A--C--V--A--A--H--H--C--N--Q--V--E--T--
GGCCTGGAACAGATCAAGCTACCTGGAAACCCCCCAGTGACCTTGATTCACCAACATCCAGCCTGCGTCGCAGCCCATCATTGCAATCAAGTGGAGACAG
                                    ::::::::::::::.:: ::::::.::::::: :::::::: ::::::::. ::::: ::::::
------------------------------------GTGACCTTGATTCATCACCATCCAACCTGCGTGGCAGCCCAACATTGCAACAAAGTGCAGACAG
-------------------------------------V--T--L--I--H--H--H--P--T--C--V--A--A--Q--H--C--N--K--V--Q--T--

----------------------------------------------------------------------------------------------------
E--S--V--G--D--V--T--Y--P--A--H--R--D--C--Y--L--G--D--L--C--N--S--A--V--A--S--H--V--A--P--A--G--I--L
AGTCGGTGGGAGACGTGACTTATCCAGCCCACAGGGACTGCTACCTGGGAGACCTGTGCAACAGCGCCGTGGCAAGCCATGTGGCCCCTGCAGGCATTTT
:::.:::::::::.::::::::. :..:::::::::::::::.: : ::.:::::::::::::::::.:::::.:::  . .::::::.... ::::. :
AGTTGGTGGGAGATGTGACTTACACGACCCACAGGGACTGCTGCGTCGGGGACCTGTGCAACAGCGCTGTGGCGAGCACCTCGGCCCCCATGTGCATCGT
E--L--V--G--D--V--T--Y--T--T--H--R--D--C--C--V--G--D--L--C--N--S--A--V--A--S--T--S--A--P--M--C--I--V

------------------------------------------------------>
--A--A--A--A--T--A--L--T--C--L--L--P--G--L--W--S--G--*-
GGCTGCAGCAGCTACCGCCCTGACCTGTCTCTTGCCAGGACTGTGGAGCGGATAG
:::::: :::::.:::::::::.:::: .::::::::::::::::::: ::.:::
GGCTGCTGCAGCCACCGCCCTGGCCTGGTTCTTGCCAGGACTGTGGAGAGGGTAG
--A--A--A--A--T--A--L--A--W--F--L--P--G--L--W--R--G--*-

Pig Consensus Sequence

>BGISUST0000896687
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------GTCCCCGCCAGACGCCTGGACTCTGTGACCTGGCTGGAGGGGAAGAGtcCTGTGAA
GGGCCACTCGAAGTCCTTCTGggGTGATGGGGCCGCCCTGCTCTTGGTGTGTCCTGGGGATGGACTACCCGAGCCCAGGGCACGGAGACCCAGAATCATT
CGCTGCCTCTTGCCTCAGAACAAAGGGGTCAGCTTTAGCCTGGCA-------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------GTGACCTTGATTCATCACCATCCAACCTGCGTGGCAGCCCAACATTGCAACAAAGTGCAGACAGAGTTGG
TGGGAGATGTGACTTACACGACCCACAGGGACTGCTGCGTCGGGGACCTGTGCAACAGCGCTGTGGCGAGCACCTCGGCCCCCATGTGCATCGTGGCTGC
TGCAGCCACCGCCCTGGCCTGGTTCTTGCCAGGACTGTGGAGAGGGTAG


>BGISUSP0000896687
----------------------------------------------------------------------------------------------------
------------------------------------------------VPARRLDSVTWLEGKSPVKGHSKSFWGDGAALLLVCPGDGLPEPRARRPRII
RCLLPQNKGVSFSLA-------------------------------------------------------------------------------------
----------VTLIHHHPTCVAAQHCNKVQTELVGDVTYTTHRDCCVGDLCNSAVASTSAPMCIVAAAATALAWFLPGLWRG*