Sequences
EST Library Info
cli1Liver - RNA from China
cov2Ovary - RNA from China
fat1Fatt
plac1Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000100577 (click for geneview)
Transcript ID ENST00000216465(link to ensembl)
Symbol GSTZ1
Localtion Chromosome:14:76857107:76867692:1 band: 14q24.3
Description Maleylacetoacetate isomerase (EC 5.2.1.2) (MAAI) (Glutathione S- transferase zeta 1) (EC 2.5.1.18) (GSTZ1-1). [Source:Uniprot/SWISSPROT;Acc:O43708]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------><--------------------------------------------------><--------------------------------
-M--Q--A--G--K--P--I--L--Y--S--Y--F--R--S--S--C--S--W--R--V--R--I--A--L--A--L--K--G--I--D--Y--E--T--
ATGCAGGCGGGGAAGCCCATCCTCTATTCCTATTTCCGAAGCTCCTGCTCATGGAGAGTTCGAATTGCTCTGGCCTTGAAAGGCATCGACTACGAGACGG
               :::::::::::::::::::::::::::::::::::.:::::::: ::::::   ::::::::::::..:::::::::.::::..:
---------------CCCATCCTCTATTCCTATTTCCGAAGCTCCTGCTCGTGGAGAGTGCGAATT---CTGGCCTTGAAAAACATCGACTATGAGATAG
----------------P--I--L--Y--S--Y--F--R--S--S--C--S--W--R--V--R--I-----L--A--L--K--N--I--D--Y--E--I--

----------------------------------><----------------------------------------------------------------
V--P--I--N--L--I--K--D--G--G--Q--Q--F--S--K--D--F--Q--A--L--N--P--M--K--Q--V--P--T--L--K--I--D--G--I
TGCCCATCAATCTCATAAAGGATGGGGGCCAACAGTTTTCTAAGGACTTCCAGGCACTGAATCCTATGAAGCAGGTGCCAACCCTGAAGATTGATGGAAT
:. :::::::.::.:::::::::::::: ::.:::::.::.::.:: :::::::: ::::::::.:::::::::::.::..:::::::::::::::::::
TAGCCATCAACCTTATAAAGGATGGGGGGCAGCAGTTCTCCAAAGAATTCCAGGCCCTGAATCCCATGAAGCAGGTACCGGCCCTGAAGATTGATGGAAT
V--A--I--N--L--I--K--D--G--G--Q--Q--F--S--K--E--F--Q--A--L--N--P--M--K--Q--V--P--A--L--K--I--D--G--I

---------------><-----------------------------------------------------------------------------------
--T--I--H--Q--S--L--A--I--I--E--Y--L--E--E--M--R--P--T--P--R--L--L--P--Q--D--P--K--K--R--A--S--V--R-
CACCATTCACCAGTCACTGGCCATCATTGAGTATCTAGAGGAGATGCGTCCCACTCCGCGACTTCTGCCTCAGGACCCAAAGAAGAGGGCCAGCGTGCGT
:::: :. .::::::::::::::::::::::::.::.:::::::. :: ::::: :: ::::::::::::::::::::::::::::::::: . :::::.
CACCCTCAGCCAGTCACTGGCCATCATTGAGTACCTGGAGGAGACCCGGCCCACGCCCCGACTTCTGCCTCAGGACCCAAAGAAGAGGGCCCAAGTGCGC
--T--L--S--Q--S--L--A--I--I--E--Y--L--E--E--T--R--P--T--P--R--L--L--P--Q--D--P--K--K--R--A--Q--V--R-

-----------------------------------------><---------------------------------------------------------
-M--I--S--D--L--I--A--G--G--I--Q--P--L--Q--N--L--S--V--L--K--Q--V--G--E--E--M--Q--L--T--W--A--Q--N--
ATGATTTCTGACCTCATCGCTGGTGGCATCCAGCCCCTGCAGAACCTGTCTGTCCTGAAGCAAGTGGGAGAGGAGATGCAGCTGACCTGGGCCCAGAACG
::::::::::::::: ::::..::::::::::.:::::::::                                                          
ATGATTTCTGACCTCCTCGCCAGTGGCATCCAACCCCTGCAG----------------------------------------------------------
-M--I--S--D--L--L--A--S--G--I--Q--P--L--Q-----------------------------------------------------------

--------------------><------------------------------------------------------><----------------------
A--I--T--C--G--F--N--A--L--E--Q--I--L--Q--S--T--A--G--I-----Y--C--V--G--D--E--V--T--M--A--D--L--C--L
CCATCACTTGTGGCTTTAACGCCCTGGAGCAGATCCTACAGAGCACAGCGGGCATA---TACTGTGTAGGAGACGAGGTGACCATGGCTGATCTGTGCTT
                       ::::::::::::::.:::::::::::::: : :   :::::..:.:::::.:::::: ::::::::::.::::::::
-----------------------CTGGAGCAGATCCTGCAGAGCACAGCGGGGAAAG--TACTGCATGGGAGATGAGGTGTCCATGGCTGACCTGTGCTT
------------------------L--E--Q--I--L--Q--S--T--A--G--K--\--Y--C--M--G--D--E--V--S--M--A--D--L--C--L

--------------------------><------------------------------------------------------------------------
--V--P--Q--V--A--N--A--E--R--F--K--V--D--L--T--P--Y--P--T--I--S--S--I--N--K--R--L--L--V--L--E--A--F-
GGTGCCTCAGGTGGCAAATGCTGAAAGATTCAAGGTGGATCTCACCCCCTACCCTACCATCAGCTCCATCAACAAGAGGCTGCTGGTCTTGGAGGCCTTC
.::::::::::::::::::::::::   : ::::::::::::: :.::::::::.:::::::::. ::::::::::   :::::::.:::::::::::::
AGTGCCTCAGGTGGCAAATGCTGAA---TACAAGGTGGATCTCTCTCCCTACCCCACCATCAGCCGCATCAACAAGTCCCTGCTGGCCTTGGAGGCCTTC
--V--P--Q--V--A--N--A--E-----Y--K--V--D--L--S--P--Y--P--T--I--S--R--I--N--K--S--L--L--A--L--E--A--F-

----------------------------------------------------->
-Q--V--S--H--P--C--R--Q--P--D--T--P--T--E--L--R--A--*-
CAGGTGTCTCACCCCTGCCGGCAGCCAGATACACCCACTGAGCTGAGGGCCTAG
::.:::::::::::: :::::::::::::::::::: :.:::::::::::::::
CAAGTGTCTCACCCCAGCCGGCAGCCAGATACACCCCCCGAGCTGAGGGCCTAG
-Q--V--S--H--P--S--R--Q--P--D--T--P--P--E--L--R--A--*-

Pig Consensus Sequence

>BGISUST0000876307
---------------CCCATCCTCTATTCCTATTTCCGAAGCTCCTGCTCGTGGAGAGTGCGAATT---CTGGCCTTGAAAAACATCGACTATGAGATAG
TAGCCATCAACCTTATAAAGGATGGGGGGCAGCAGTTCTCCAAAGAATTCCAGGCCCTGAATCCCATGAAGCAGGTACCGGCCCTGAAGATTGATGGAAT
CACCCTCAGCCAGTCACTGGCCATCATTGAGTACCTGGAGGAGACCCGGCCCACGCCCCGACTTCTGCCTCAGGACCCAAAGAAGAGGGCCCAAGTGCGC
ATGATTTCTGACCTCCTCGCCAGTGGCATCCAACCCCTGCAG----------------------------------------------------------
-----------------------CTGGAGCAGATCCTGCAGAGCACAGCGGGGAAatACTGCATGGGAGATGAGGTGTCCATGGCTGACCTGTGCTTAGT
GCCTCAGGTGGCAAATGCTGAA---TACAAGGTGGATCTCTCTCCCTACCCCACCATCAGCCGCATCAACAAGTCCCTGCTGGCCTTGGAGGCCTTCCAA
GTGTCTCACCCCAGCCGGCAGCCAGATACACCCCCCGAGCTGAGGGCCTAG


>BGISUSP0000876307
-----PILYSYFRSSCSWRVRI-LALKNIDYEIVAINLIKDGGQQFSKEFQALNPMKQVPALKIDGITLSQSLAIIEYLEETRPTPRLLPQDPKKRAQVR
MISDLLASGIQPLQ---------------------------LEQILQSTAGKYCMGDEVSMADLCLVPQVANAE-YKVDLSPYPTISRINKSLLALEAFQ
VSHPSRQPDTPPELRA*