Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000100580 (click for geneview)
Transcript ID ENST00000216468(link to ensembl)
Symbol TMED8
Localtion Chromosome:14:76871119:76913191:-1 band: 14q24.3
Description Protein TMED8 (L10). [Source:Uniprot/SWISSPROT;Acc:Q6PL24]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--D--L--Q--A--A--E--G--P--G--S--W--S--P--T--A--R--P--G--S--A--G--G--V--G--D--C--Q--G--V--E--G--
ATGTCTGACCTGCAGGCGGCTGAGGGGCCGGGCTCCTGGAGCCCCACAGCCCGCCCAGGGTCGGCTGGCGGCGTCGGGGACTGCCAGGGAGTGGAGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------><-----------------------------------------------------------------------------><--
S--Q--A--A--A--S--E--N--E--D--L--E--N--K--D--T--S--L--L--A--S--A--T--D--P--E--P--C--S--S--P--H--R--P
GCCAGGCGGCCGCCTCAGAGAATGAAGATCTAGAAAACAAGGATACCTCTTTATTGGCTTCTGCCACCGATCCAGAACCCTGCTCCTCACCCCACAGGCC
                                                                                                  ::
--------------------------------------------------------------------------------------------------CC
---------------------------------------------------------------------------------------------------P

----------------------------------------------------------------------------------------------------
--Q--M--V--S--P-----V--S--K--D--A--T--E--D--L--R--K--A--T--G--P--L--E--A--Q--A--L--V--K--Q--D--L--L-
ACAGATGGTATCTCCA---GTGAGTAAGGATGCCACGGAAGATCTGCGGAAAGCAACTGGTCCTTTGGAGGCTCAGGCCTTGGTGAAACAGGATTTGCTG
.:::::::::::::::   :  :: .::::::::. :::::..:.::.:::.:::.::::: :. :::::::::::::: :::::.::::::: ::::::
GCAGATGGTATCTCCAG--GGNAGGGAGGATGCCGAGGAAGGCCCGCAGAAGGCAGCTGGTGCCGTGGAGGCTCAGGCCATGGTGGAACAGGAATTGCTG
--Q--M--V--S--P--\--X--R--E--D--A--E--E--G--P--Q--K--A--A--G--A--V--E--A--Q--A--M--V--E--Q--E--L--L-

-----------------------------><---------------------------------------------------------------------
-P--A--D--Q--A--Q--V--L--N--E--M--A--K--Y--Q--V--P--Q--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--
CCTGCAGACCAGGCCCAGGTCCTCAATGAGATGGCTAAGTATCAAGTTCCACAGAGGTCTGGGGACATCGTTATGATCCAGTCTGAACATACAGGAGCTA
:::::::.:::::::::::::::::...::      :.:::.:  : :::.: .::::::::::::::::::::::::::::: ::.::.::.:::::.:
CCTGCAGGCCAGGCCCAGGTCCTCAGCAAG------AGGTACCCCGGTCCGCCAAGGTCTGGGGACATCGTTATGATCCAGTCGGAGCACACGGGAGCCA
-P--A--G--Q--A--Q--V--L--S--K--------R--Y--P--G--P--P--R--S--G--D--I--V--M--I--Q--S--E--H--T--G--A--

--------------------------------------------------------><------------------------------------------
I--D--V--L--S--A--D--L--E--S--A--D--L--L--G--D--H--R--K--V--S--P--P--L--M--A--P--P--C--I--W--T--F--A
TAGATGTTCTTTCAGCTGATTTGGAATCTGCAGATCTTCTGGGGGACCACAGGAAAGTCTCCCCACCTCTGATGGCTCCTCCATGCATCTGGACCTTTGC
:::::..:::::::::::::.:::::::::::::.::.:::::::::::::::                                               
TAGATACTCTTTCAGCTGATCTGGAATCTGCAGACCTCCTGGGGGACCACAGG-----------------------------------------------
I--D--T--L--S--A--D--L--E--S--A--D--L--L--G--D--H--R------------------------------------------------

----------------------------------------------------------------------------------------------------
--K--V--K--E--F--K--S--K--L--G--K--E--K--N--S--R--L--V--V--K--R--G--E--V--V--T--I--R--V--P--T--H--P-
CAAGGTGAAGGAATTCAAAAGCAAGCTGGGCAAAGAGAAGAACAGCCGTCTGGTGGTGAAGCGTGGTGAGGTGGTGACCATCCGGGTACCTACTCATCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--G--K--R--V--C--W--E--F--A--T--D--D--Y--D--I--G--F--G--V--Y--F--D--W--T--P--V--T--S--T--D--I--T--
GAGGGGAAGCGTGTCTGCTGGGAGTTTGCGACCGATGACTATGACATTGGCTTTGGAGTTTATTTTGACTGGACCCCTGTAACTAGCACTGACATAACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
V--Q--V--S--D--S--S--D--D--E--D--E--E--E--E--E--E--E--E--I--E--E--P--V--P--A--G--D--V--E--R--G--S--R
TGCAGGTCAGTGATTCCAGTGACGATGAGGATGAAGAAGAGGAAGAGGAGGAAGAGATTGAAGAACCCGTTCCAGCTGGAGATGTGGAGAGAGGCTCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--S--L--R--G--R--Y--G--E--V--M--P--V--Y--R--R--D--S--H--R--D--V--Q--A--G--S--H--D--Y--P--G--E--G-
GAGCTCCTTGCGGGGTCGCTATGGGGAGGTCATGCCTGTGTACCGGCGGGACAGCCACCGAGACGTGCAGGCTGGCAGCCATGACTACCCTGGTGAGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------->
-I--Y--L--L--K--F--D--N--S--Y--S--L--L--R--N--K--T--L--Y--F--H--I--Y--Y--T--S--*-
ATCTACCTGCTCAAGTTCGACAACTCCTACTCCCTGCTGCGCAACAAGACTCTCTACTTCCACATCTACTACACCAGCTGA
                                                                                 
---------------------------------------------------------------------------------
---------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000878683
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------CC
GCAGATGGTATCTCCagGNAGGGAGGATGCCGAGGAAGGCCCGCAGAAGGCAGCTGGTGCCGTGGAGGCTCAGGCCATGGTGGAACAGGAATTGCTGCCT
GCAGGCCAGGCCCAGGTCCTCAGCAAG------AGGTACCCCGGTCCGCCAAGGTCTGGGGACATCGTTATGATCCAGTCGGAGCACACGGGAGCCATAG
ATACTCTTTCAGCTGATCTGGAATCTGCAGACCTCCTGGGGGACCACAGG--------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------


>BGISUSP0000878683
------------------------------------------------------------------PQMVSP-REDAEEGPQKAAGAVEAQAMVEQELLP
AGQAQVLSK--RYPGPPRSGDIVMIQSEHTGAIDTLSADLESADLLGDHR--------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------