Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000110244 (click for geneview)
Transcript ID ENST00000227666(link to ensembl)
Localtion Chromosome:11:116196628:116199230:-1 band: 11q23.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------><--------------------------------------------------
-M--F--L--K--A--V--V--L--T--L--A--L--V--A--V--A--G--A--R--A--E--V--S--A--D--Q--V--A--T--V--M--W--D--
ATGTTCCTGAAGGCCGTGGTCCTGACCCTGGCCCTGGTGGCTGTCGCCGGAGCCAGGGCTGAGGTCAGTGCTGACCAGGTGGCCACGGTGATGTGGGACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------><-----------------------
Y--F--S--Q--L--S--N--N--A--K--E--A--V--E--H--L--Q--K--S--E--L--T--Q--Q--L--N--A--L--F--Q--D--K--L--G
ACTTCAGCCAGCTGAGCAACAATGCCAAGGAGGCCGTGGAACATCTCCAGAAATCTGAACTCACCCAGCAACTCAATGCCCTCTTCCAGGACAAACTTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--V--N--T--Y--A--G--D--L--Q--K--K--L--V--P--F--A--T--E--L--H--E--R--L--A--K--D--S--E--K--L--K--E-
AGAAGTGAACACTTACGCAGGTGACCTGCAGAAGAAGCTGGTGCCCTTTGCCACCGAGCTGCATGAACGCCTGGCCAAGGACTCGGAGAAACTGAAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--I--G--K--E--L--E--E--L--R--A--R--L--L--P--H--A--N--E--V--S--Q--K--I--G--D--N--L--R--E--L--Q--Q--
GAGATTGGGAAGGAGCTGGAGGAGCTGAGGGCCCGGCTGCTGCCCCATGCCAATGAGGTGAGCCAGAAGATCGGGGACAACCTGCGAGAGCTTCAGCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--L--E--P--Y--A--D--Q--L--R--T--Q--V--S--T--Q--A--E--Q--L--R--R--Q--L--T--P--Y--A--Q--R--M--E--R--V
GCCTGGAGCCCTACGCGGACCAGCTGCGCACCCAGGTCAGCACGCAGGCCGAGCAGCTGCGGCGCCAGCTGACCCCCTACGCACAGCGCATGGAGAGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--R--E--N--A--D--S--L--Q--A--S--L--R--P--H--A--D--E--L--K--A--K--I--D--Q--N--V--E--E--L--K--G--R-
GCTGCGGGAGAACGCCGACAGCCTGCAGGCCTCGCTGAGGCCCCACGCCGACGAGCTCAAGGCCAAGATCGACCAGAACGTGGAGGAGCTCAAGGGACGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--T--P--Y--A--D--E--F--K--V--K--I--D--Q--T--V--E--E--L--R--R--S--L--A--P--Y--A--Q--D--T--Q--E--K--
CTTACGCCCTACGCTGACGAATTCAAAGTCAAGATTGACCAGACCGTGGAGGAGCTGCGCCGCAGCCTGGCTCCCTATGCTCAGGACACGCAGGAGAAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--N--H--Q--L--E--G--L--T--F--Q--M--K--K--N--A--E--E--L--K--A--R--I--S--A--S--A--E--E--L--R--Q--R--L
TCAACCACCAGCTTGAGGGCCTGACCTTCCAGATGAAGAAGAACGCCGAGGAGCTCAAGGCCAGGATCTCGGCCAGTGCCGAGGAGCTGCGGCAGAGGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--P--L--A--E--D--V--R--G--N--L--R--G--N--T--E--G--L--Q--K--S--L--A--E--L--G--G--H--L--D--Q--Q--V-
GGCGCCCTTGGCCGAGGACGTGCGTGGCAACCTGAGGGGCAACACCGAGGGGCTGCAGAAGTCACTGGCAGAGCTGGGTGGGCACCTGGACCAGCAGGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--E--F--R--R--R--V--E--P--Y--G--E--N--F--N--K--A--L--V--Q--Q--M--E--Q--L--R--Q--K--L--G--P--H--A--
GAGGAGTTCCGACGCCGGGTGGAGCCCTACGGGGAAAACTTCAACAAAGCCCTGGTGCAGCAGATGGAACAGCTCAGGCAGAAACTGGGCCCCCATGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--D--V--E--G--H--L--S--F--L--E--K--D--L--R--D--K--V--N--S--F--F--S--T--F--K--E--K--E--S--Q--D--K--T
GGGACGTGGAAGGCCACTTGAGCTTCCTGGAGAAGGACCTGAGGGACAAGGTCAACTCCTTCTTCAGCACCTTCAAGGAGAAAGAGAGCCAGGACAAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------>
--L--S--L--P--E--L--E--Q--Q--Q--E--Q--Q--Q--E--Q--Q--Q--E--Q--V--Q--M--L--A--P--L--E--S--*-
TCTCTCCCTCCCTGAGCTGGAGCAACAGCAGGAACAGCAGCAGGAGCAGCAGCAGGAGCAGGTGCAGATGCTGGCCCCTTTGGAGAGCTGA
                                                                                           
-------------------------------------------------------------------------------------------
-------------------------------------------------------------------------------------------