Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000110245 (click for geneview)
Transcript ID ENST00000227667(link to ensembl)
Symbol APOC3
Localtion Chromosome:11:116205834:116208997:1 band: 11q23.3
Description Apolipoprotein C-III precursor (Apo-CIII) (ApoC-III). [Source:Uniprot/SWISSPROT;Acc:P02656]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------><--------------------------------------------
-M--Q--P--R--V--L--L--V--V--A--L--L--A--L--L--A--S--A--R--A--S--E--A--E--D--A--S--L--L--S--F--M--Q--
ATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGGATGCCTCCCTTCTCAGCTTCATGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
G--Y--M--K--H--A--T--K--T--A--K--D--A--L--S--S--V--Q--E--S--Q--V--A--Q--Q--A--R--G--W--V--T--D--G--F
GTTACATGAAGCACGCCACCAAGACCGCCAAGGATGCACTGAGCAGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCGATGGCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------->
--S--S--L--K--D--Y--W--S--T--V--K--D--K--F--S--E--F--W--D--L--D--P--E--V--R--P--T--S--A--V--A--A--*-
CAGTTCCCTGAAAGACTACTGGAGCACCGTTAAGGACAAGTTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------