Sequences
EST Library Info
cli3Liver - RNA from China
eje1Foetus 50 days, jejunum
plac1Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000111964 (click for geneview)
Transcript ID ENST00000229690(link to ensembl)
Symbol APOM
Localtion Chromosome:6:31731650:31733965:1 band: 6p21.33
Description Apolipoprotein M (Apo-M) (ApoM) (NG20 protein) (G3a protein). [Source:Uniprot/SWISSPROT;Acc:O95445]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--F--H--Q--I--W--A--A--L--L--Y--F--Y--G--I--I--L--N--S--I--Y--Q--C--P--E--H--S--Q--L--T--T--L--G--
ATGTTCCACCAAATTTGGGCAGCTCTGCTCTACTTCTATGGTATTATCCTTAACTCCATCTACCAGTGCCCTGAGCACAGTCAACTGACAACTCTGGGCG
:::::::::::.::::::::::::::.::::::.:::::::.::: :::::::::::::::::::::::::::::::::::::::::::::::  .:: :
ATGTTCCACCAGATTTGGGCAGCTCTACTCTACCTCTATGGCATTCTCCTTAACTCCATCTACCAGTGCCCTGAGCACAGTCAACTGACAACTGGAGGAG
-M--F--H--Q--I--W--A--A--L--L--Y--L--Y--G--I--L--L--N--S--I--Y--Q--C--P--E--H--S--Q--L--T--T--G--G--

-------------><-------------------------------------------------------------------------------------
V--D--G--K--E--F--P--E--V--H--L--G--Q--W--Y--F--I--A--G--A--A--P--T--K--E--E--L--A--T--F--D--P--V--D
TGGATGGGAAGGAGTTCCCAGAGGTCCACTTGGGCCAGTGGTACTTTATCGCAGGGGCAGCTCCCACCAAGGAGGAGTTGGCAACTTTTGACCCTGTGGA
::::::::::.::::::::: :: .::::.:::::::::::::::::::::::::::::::::: :::::::::::::::::.:::::::::::::::::
TGGATGGGAAAGAGTTCCCACAGCCCCACCTGGGCCAGTGGTACTTTATCGCAGGGGCAGCTCCAACCAAGGAGGAGTTGGCGACTTTTGACCCTGTGGA
V--D--G--K--E--F--P--Q--P--H--L--G--Q--W--Y--F--I--A--G--A--A--P--T--K--E--E--L--A--T--F--D--P--V--D

--------------------------------------------------------------------><------------------------------
--N--I--V--F--N--M--A--A--G--S--A--P--M--Q--L--H--L--R--A--T--I--R--M--K--D--G--L--C--V--P--R--K--W-
CAACATTGTCTTCAATATGGCTGCTGGCTCTGCCCCGATGCAGCTCCACCTTCGTGCTACCATCCGCATGAAAGATGGGCTCTGTGTGCCCCGGAAATGG
:::::::::::::::.:::::::: :::::::..:: ::::::::::: ::::: ::::::::::::   :::.::::::::::::::::::::::::::
CAACATTGTCTTCAACATGGCTGCAGGCTCTGTTCCCATGCAGCTCCAGCTTCGAGCTACCATCCGC---AAAAATGGGCTCTGTGTGCCCCGGAAATGG
--N--I--V--F--N--M--A--A--G--S--V--P--M--Q--L--Q--L--R--A--T--I--R-----K--N--G--L--C--V--P--R--K--W-

------------------------------------------><--------------------------------------------------------
-I--Y--H--L--T--E--G--S--T--D--L--R--T--E--G--R--P--D--M--K--T--E--L--F--S--S--S--C--P--G--G--I--M--
ATCTACCACCTGACTGAAGGGAGCACAGATCTCAGAACTGAAGGCCGCCCTGACATGAAGACTGAGCTCTTTTCCAGCTCATGCCCAGGTGGAATCATGC
:::::::.:::: ::::.::.:.::::::::::::::: :::   :::::::::::::::::..:::::::.::.::: :::::::::::::::::::::
ATCTACCGCCTGTCTGAGGGAAACACAGATCTCAGAACAGAA---CGCCCTGACATGAAGACCAAGCTCTTCTCTAGCACATGCCCAGGTGGAATCATGC
-I--Y--R--L--S--E--G--N--T--D--L--R--T--E-----R--P--D--M--K--T--K--L--F--S--S--T--C--P--G--G--I--M--

-----------------------------------------><---------------------------------------------------------
L--N--E--T--G--Q--G--Y--Q--R--F--L--L--Y--N--R--S--P--H--P--P--E--K--C--V--E--E--F--K--S--L--T--S--C
TGAATGAGACAGGCCAGGGTTACCAGCGCTTTCTCCTCTACAATCGCTCACCACATCCTCCCGAAAAGTGTGTGGAGGAATTCAAGTCCCTGACTTCCTG
:::: ::::::::::::::::::::::::::.:::::::::                                                           
TGAAAGAGACAGGCCAGGGTTACCAGCGCTTCCTCCTCTAC-----------------------------------------------------------
L--K--E--T--G--Q--G--Y--Q--R--F--L--L--Y------------------------------------------------------------

----------------------------------------><------------------------>
--L--D--S--K--A--F--L--L--T--P--R--N--Q--E--A--C--E--L--S--N--N--*-
CCTGGACTCCAAAGCCTTCTTATTGACTCCTAGGAATCAAGAGGCCTGTGAGCTGTCCAATAACTGA
                                                                   
-------------------------------------------------------------------
-------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000896103
ATGTTCCACCAGATTTGGGCAGCTCTACTCTACCTCTATGGCATTCTCCTTAACTCCATCTACCAGTGCCCTGAGCACAGTCAACTGACAACTGGAGGAG
TGGATGGGAAAGAGTTCCCACAGCCCCACCTGGGCCAGTGGTACTTTATCGCAGGGGCAGCTCCAACCAAGGAGGAGTTGGCGACTTTTGACCCTGTGGA
CAACATTGTCTTCAACATGGCTGCAGGCTCTGTTCCCATGCAGCTCCAGCTTCGAGCTACCATCCGC---AAAAATGGGCTCTGTGTGCCCCGGAAATGG
ATCTACCGCCTGTCTGAGGGAAACACAGATCTCAGAACAGAA---CGCCCTGACATGAAGACCAAGCTCTTCTCTAGCACATGCCCAGGTGGAATCATGC
TGAAAGAGACAGGCCAGGGTTACCAGCGCTTCCTCCTCTAC-----------------------------------------------------------
-------------------------------------------------------------------


>BGISUSP0000896103
MFHQIWAALLYLYGILLNSIYQCPEHSQLTTGGVDGKEFPQPHLGQWYFIAGAAPTKEELATFDPVDNIVFNMAAGSVPMQLQLRATIR-KNGLCVPRKW
IYRLSEGNTDLRTE-RPDMKTKLFSSTCPGGIMLKETGQGYQRFLLY------------------------------------------