Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000111971 (click for geneview)
Transcript ID ENST00000229698(link to ensembl)
Symbol LY6G5C
Localtion Chromosome:6:31752713:31759796:-1 band: 6p21.33
Description lymphocyte antigen 6 complex, locus G5C (LY6G5C), transcript variant 3, mRNA [Source:RefSeq_dna;Acc:NM_025262]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------><------------------------------------------------
-A--D--L--P--S--C--W--G--A--G--P--C--Y--T--G--H--K--V--G--A--L--R--R--D--T--V--I--C--C--C--R--H--G--
GCAGACCTTCCCAGTTGCTGGGGCGCTGGACCCTGCTATACTGGACACAAGGTAGGAGCACTCAGAAGGGACACCGTCATCTGCTGCTGTCGCCATGGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--Y--S--T--P--C--L--F--T--P--G--K--P--S--R--N--P--S--P--W--K--R--T--L--W--T--L--S--A--P--W--A--G--P
ATTATTCAACGCCCTGCCTCTTCACCCCAGGAAAACCTTCGCGGAACCCGTCACCATGGAAACGAACTCTCTGGACTCTTAGCGCGCCCTGGGCTGGCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--G--W--T--G--E--E--Q--N--A--T--K--T--G--L--I--T--R--R--P--R--P--L--R--R--R--P--H--P--A--P--A--S-
TGCTGGGTGGACAGGAGAGGAGCAAAACGCAACAAAGACGGGATTAATTACTCGGAGGCCGCGCCCCCTCCGAAGAAGGCCCCACCCTGCCCCGGCCTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------><--------------------------------------------------------
-P--L--P--E--I--I--R--G--N--I--P--R--M--L--G--K--F--V--P--V--N--W--E--P--P--Q--P--L--P--F--P--K--Y--
CCCCTCCCCGAAATAATTCGAGGAAATATTCCGCGAATGCTGGGTAAGTTTGTTCCTGTCAATTGGGAACCCCCTCAACCACTTCCATTCCCCAAATACC
                                             .:::::: :: :. ..::. .::::::::::: ::. ::: .::  ::::::::.
---------------------------------------------GAGTTTGATCATAATGATCCAGAACCCCCTCATCCGATTCAGTTAACCAAATACT
----------------------------------------------E--F--D--H--N--D--P--E--P--P--H--P--I--Q--L--T--K--Y--

----------------------------------------------------------------------------------------------------
L--R--C--Y--R--C--L--L--E--T--K--E--L--G--C--L--L--G--S--D--I--C--L--T--P--A--G--S--S--C--I--T--L--H
TGCGCTGCTACCGATGCCTCTTGGAGACCAAGGAGTTAGGGTGCCTTCTGGGATCTGACATCTGCCTCACCCCAGCTGGCAGCAGCTGCATCACTCTCCA
:. :::::::.:::::::::.::::::::::.:::::.::::::::::::::::::::::::::::::::::::.  :::::::::::::: :::::   
TAAGCTGCTATCGATGCCTCCTGGAGACCAAAGAGTTGGGGTGCCTTCTGGGATCTGACATCTGCCTCACCCCAAAGGGCAGCAGCTGCATGACTCTGAT
L--S--C--Y--R--C--L--L--E--T--K--E--L--G--C--L--L--G--S--D--I--C--L--T--P--K--G--S--S--C--M--T--L--I

----------><----------------------------------------------------------------------------------------
--K--K--N--S--S--G--S--D--V--M--V--S--D--C--R--S--K--E--Q--M--S--D--C--S--N--T--R--T--S--P--V--S--G-
CAAAAAGAACAGCAGCGGTTCTGACGTCATGGTGAGTGACTGCCGAAGTAAGGAGCAGATGAGTGATTGTTCAAATACCCGAACTTCTCCGGTGTCTGGC
:: :::::::                                                                                          
CATAAAGAAC------------------------------------------------------------------------------------------
--I--K--N-------------------------------------------------------------------------------------------

-------------------------------------------------------------------------->
-F--W--I--F--S--Q--Y--C--F--L--D--F--C--N--D--P--Q--N--R--G--L--Y--T--P--*-
TTCTGGATATTCTCTCAATACTGCTTCCTGGATTTCTGCAATGACCCTCAAAACAGAGGGCTCTATACTCCTTAG
                                                                           
---------------------------------------------------------------------------
---------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000880335
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------GAGTTTGATCATAATGATCCAGAACCCCCTCATCCGATTCAGTTAACCAAATACT
TAAGCTGCTATCGATGCCTCCTGGAGACCAAAGAGTTGGGGTGCCTTCTGGGATCTGACATCTGCCTCACCCCAAAGGGCAGCAGCTGCATGACTCTGAT
CATAAAGAAC------------------------------------------------------------------------------------------
---------------------------------------------------------------------------


>BGISUSP0000880335
----------------------------------------------------------------------------------------------------
---------------EFDHNDPEPPHPIQLTKYLSCYRCLLETKELGCLLGSDICLTPKGSSCMTLIIKN------------------------------
-------------------------